ID: 1071323992

View in Genome Browser
Species Human (GRCh38)
Location 10:84493718-84493740
Sequence ACTTTTCCACAGATGGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071323984_1071323992 18 Left 1071323984 10:84493677-84493699 CCCAACCTTTTTGACATCAGGGA 0: 7
1: 134
2: 1225
3: 1719
4: 1412
Right 1071323992 10:84493718-84493740 ACTTTTCCACAGATGGGGAGAGG No data
1071323985_1071323992 17 Left 1071323985 10:84493678-84493700 CCAACCTTTTTGACATCAGGGAC 0: 9
1: 139
2: 1201
3: 1809
4: 1400
Right 1071323992 10:84493718-84493740 ACTTTTCCACAGATGGGGAGAGG No data
1071323987_1071323992 13 Left 1071323987 10:84493682-84493704 CCTTTTTGACATCAGGGACTGGT 0: 5
1: 59
2: 632
3: 945
4: 1431
Right 1071323992 10:84493718-84493740 ACTTTTCCACAGATGGGGAGAGG No data
1071323982_1071323992 19 Left 1071323982 10:84493676-84493698 CCCCAACCTTTTTGACATCAGGG 0: 8
1: 122
2: 1228
3: 1681
4: 1313
Right 1071323992 10:84493718-84493740 ACTTTTCCACAGATGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071323992 Original CRISPR ACTTTTCCACAGATGGGGAG AGG Intronic
No off target data available for this crispr