ID: 1071324075

View in Genome Browser
Species Human (GRCh38)
Location 10:84494480-84494502
Sequence TCCTGGGAATGTAGTCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071324067_1071324075 21 Left 1071324067 10:84494436-84494458 CCTTCTCATCCAGTGACTCATCC No data
Right 1071324075 10:84494480-84494502 TCCTGGGAATGTAGTCCAGCTGG No data
1071324069_1071324075 12 Left 1071324069 10:84494445-84494467 CCAGTGACTCATCCGGTGACTGA No data
Right 1071324075 10:84494480-84494502 TCCTGGGAATGTAGTCCAGCTGG No data
1071324066_1071324075 25 Left 1071324066 10:84494432-84494454 CCAACCTTCTCATCCAGTGACTC No data
Right 1071324075 10:84494480-84494502 TCCTGGGAATGTAGTCCAGCTGG No data
1071324070_1071324075 0 Left 1071324070 10:84494457-84494479 CCGGTGACTGAGAATGCCTAACC No data
Right 1071324075 10:84494480-84494502 TCCTGGGAATGTAGTCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071324075 Original CRISPR TCCTGGGAATGTAGTCCAGC TGG Intronic