ID: 1071324921

View in Genome Browser
Species Human (GRCh38)
Location 10:84504187-84504209
Sequence CTAAATGCTCATATTTATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 384}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071324921_1071324924 7 Left 1071324921 10:84504187-84504209 CCCATATAAATATGAGCATTTAG 0: 1
1: 0
2: 0
3: 32
4: 384
Right 1071324924 10:84504217-84504239 TATACTGACTTTAAATATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071324921 Original CRISPR CTAAATGCTCATATTTATAT GGG (reversed) Intronic
900842514 1:5065928-5065950 CTAAATCCTCATAATTCTTTTGG - Intergenic
902952853 1:19900671-19900693 CTAAATTCCCATATGTATTTGGG + Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909340442 1:74525682-74525704 CTCCATGGTCATATTTATATTGG - Intronic
909400464 1:75222984-75223006 TTAAATTCTAATACTTATATTGG - Intronic
909829461 1:80168666-80168688 AATAATGCTCTTATTTATATAGG + Intergenic
909865140 1:80659084-80659106 TTAAATGCTTATATTAAAATAGG + Intergenic
909954024 1:81754857-81754879 TTAAATGCTCATAATAATTTGGG - Intronic
910890938 1:92019319-92019341 CTATATGTTCATATTTGAATGGG - Intergenic
911032198 1:93501124-93501146 TTAAATTCTCAGATTTCTATTGG + Intronic
911956882 1:104247527-104247549 ATAAATGCTTATTTTTTTATTGG - Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
912412138 1:109486853-109486875 CTAAAGGCTCAGATTCAAATGGG + Intronic
913606741 1:120474285-120474307 ATATATGCACATATTTATATGGG + Intergenic
915651058 1:157311259-157311281 GTAAATGCTGATATTTGCATTGG - Intergenic
917034594 1:170733866-170733888 CTAAATGATAATACATATATGGG + Intronic
917544572 1:175949981-175950003 CTAGATTATCTTATTTATATTGG - Intronic
917752969 1:178070837-178070859 CTAAATACTCATTTTAATTTAGG - Intergenic
918790794 1:188825124-188825146 CTAAATCTTTATATTTACATTGG - Intergenic
919004367 1:191876152-191876174 ATAAATGCTAATATTTAATTGGG + Intergenic
919273939 1:195387216-195387238 CACCATGTTCATATTTATATAGG + Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920527548 1:206678825-206678847 GTAACTGCTCACATTTATAGAGG + Intronic
921659218 1:217778952-217778974 CTAAATACACTTATGTATATAGG - Intronic
924849808 1:247815658-247815680 CAAAATGCACATATTTTTATTGG + Exonic
1063040010 10:2328436-2328458 ATATATGCTCATAATAATATAGG + Intergenic
1063040011 10:2328533-2328555 ATATATGCTCATAATAATATAGG + Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066508036 10:36065698-36065720 ATAAATCCTCCTCTTTATATAGG + Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1067932243 10:50574317-50574339 TTCAATGCTCATTTTTAAATTGG - Intronic
1068318300 10:55376600-55376622 TTAAAGGGCCATATTTATATGGG - Intronic
1069176201 10:65291983-65292005 ATGAATGCTAATATTTATGTAGG - Intergenic
1069584959 10:69593384-69593406 CAAAATGCATATATATATATTGG - Intergenic
1070545661 10:77450409-77450431 ATAAATGTTAATATGTATATTGG - Intronic
1071042614 10:81332541-81332563 CTATATTCTCATCTTTATAATGG - Intergenic
1071288969 10:84174447-84174469 CTAAATATTCATATCTATAGAGG - Intronic
1071324921 10:84504187-84504209 CTAAATGCTCATATTTATATGGG - Intronic
1071396200 10:85226389-85226411 CTAAGTGATCTTATTTATCTGGG + Intergenic
1071489913 10:86129212-86129234 CTGAATGCTCATATGGAGATGGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1072914487 10:99529444-99529466 CTTAATGCACATATAAATATAGG - Intergenic
1073907263 10:108296826-108296848 CTACATGCCCATATCTATGTTGG - Intergenic
1075595533 10:123726520-123726542 CTAAAAGCTCATTTTTAGGTAGG - Intronic
1076324759 10:129612612-129612634 GTAATTGTTCCTATTTATATGGG - Intronic
1077070704 11:670356-670378 CTTAATGCTGAAATTTATAGAGG - Intronic
1078805907 11:14703126-14703148 CAAATTGCTCATATTTTTTTGGG + Intronic
1079197101 11:18338607-18338629 CTAAATTTTCTTATTTTTATAGG + Intronic
1079426766 11:20350989-20351011 CTGACGGCTCATATTTTTATTGG + Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1080098767 11:28435328-28435350 CTAAATGAGAATACTTATATAGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1081133443 11:39408510-39408532 CAAAATTCTAAAATTTATATAGG + Intergenic
1082195530 11:49299809-49299831 CTTAAAGATCATAGTTATATAGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1085165553 11:74396856-74396878 TTAATTGGTCATATGTATATTGG - Intronic
1086362753 11:86075987-86076009 CTTAATGCTAATGTTAATATTGG + Intergenic
1086660406 11:89409754-89409776 CTTAAAGATCATAGTTATATAGG + Intronic
1086834718 11:91606293-91606315 TTAAATCCTCATATTTACACAGG - Intergenic
1086914324 11:92511391-92511413 CCAAATGCTCTTATTCATAGGGG + Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088705426 11:112459149-112459171 GTAAAAGTTCGTATTTATATAGG - Intergenic
1089075769 11:115737285-115737307 CTAATTGCTCATAATTACATTGG + Intergenic
1090222025 11:125034921-125034943 ATAAACTCTCATATATATATGGG + Intronic
1090856256 11:130611403-130611425 CTAAATCCTCATCTATAAATGGG + Intergenic
1093040394 12:14372530-14372552 CCAGATTCTCATATTCATATAGG - Intronic
1093108094 12:15113960-15113982 CAATAGACTCATATTTATATAGG + Intronic
1093327829 12:17801602-17801624 TTAAATGTTTATATTTTTATGGG - Intergenic
1093514418 12:19969258-19969280 CTAAATTGTCATTTTTATAAGGG - Intergenic
1093860124 12:24155222-24155244 CTAAATTCTCATCTCTACATAGG - Intergenic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095614069 12:44167927-44167949 CTAAGTGCCCATATTCAGATAGG + Intronic
1096766892 12:53898478-53898500 CTAAGTGGCCATGTTTATATTGG + Intergenic
1098102489 12:67032922-67032944 TTAAATAATCATTTTTATATTGG - Intergenic
1098408323 12:70151242-70151264 CCAAGTGCTCATAATCATATTGG + Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099539530 12:83889723-83889745 CTCAGTGATCATATCTATATTGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1101064324 12:101003668-101003690 GTAATTGCACATATTTATATAGG + Intronic
1102443339 12:112980133-112980155 ATAATTGTGCATATTTATATGGG + Intronic
1102545948 12:113655622-113655644 CTAAAAGCTCATGTTTTTACTGG - Intergenic
1104092816 12:125529926-125529948 CTACATTCTCATATATATATGGG + Intronic
1105233971 13:18528285-18528307 CTTATTGCCCATATATATATAGG - Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1106232520 13:27831907-27831929 CTAAGAGTTCACATTTATATAGG - Intergenic
1107557696 13:41532088-41532110 CCAAATGCCCATGTGTATATTGG - Intergenic
1108401142 13:50045294-50045316 CAAACTGCACATAGTTATATAGG - Intergenic
1108821552 13:54357043-54357065 CTGAATGCTCTCATTTACATAGG - Intergenic
1108903200 13:55437743-55437765 CTATATGTTCATTTTTATAAAGG + Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109564828 13:64098422-64098444 TTAGATGCTTGTATTTATATAGG + Intergenic
1109812250 13:67528584-67528606 TTGAATGCTCATATTTAATTGGG + Intergenic
1110465243 13:75792828-75792850 ATAAATGCTCATATTTAGAAGGG + Intronic
1111167626 13:84481195-84481217 CCAAATGATCACATTTATAGTGG + Intergenic
1111208733 13:85048959-85048981 ATAAATACTTATATTTCTATAGG - Intergenic
1111884405 13:94001490-94001512 CTAAATTCTTATATGAATATAGG + Intronic
1112666358 13:101578950-101578972 GTGAATGCTCATATATATTTGGG + Intronic
1113084859 13:106558291-106558313 ATACATGCTTATATTTATAGTGG - Intronic
1113099436 13:106701417-106701439 ATAAATGCTCATATTTGCAAAGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114746125 14:25149234-25149256 GTAACTGCACATATTTGTATGGG + Intergenic
1115058026 14:29154641-29154663 CTGAATGCTCATACATATACAGG + Intergenic
1116209778 14:41921127-41921149 CTAAAAGAGCATATTTTTATGGG + Intergenic
1116308144 14:43284458-43284480 GTAAATTCTCATATTTCTATTGG + Intergenic
1116599157 14:46896562-46896584 TTTAATGCTCATATTAAAATTGG - Intronic
1116880709 14:50165910-50165932 ATAAACTCTCCTATTTATATTGG - Intronic
1117088472 14:52225473-52225495 TTAAATACCCATATTTCTATTGG + Intergenic
1117566357 14:56997555-56997577 CTAAATGCTAATATTCAGAGAGG - Intergenic
1117877163 14:60265109-60265131 CTAAAACCACATCTTTATATTGG + Intronic
1117948091 14:61052616-61052638 CGAAATGCTCTTAAATATATTGG + Intronic
1118632679 14:67720615-67720637 CTAAATGCCCATGTGTATTTGGG + Intronic
1118898406 14:69966123-69966145 GTAAATGCTCCTATTTATGAGGG + Intronic
1119281077 14:73408369-73408391 CTCAGTCCTCAAATTTATATTGG + Intronic
1120085728 14:80270438-80270460 CTAGAAGATCATATTTATAAAGG + Intronic
1120631612 14:86898527-86898549 ATAAAAACTGATATTTATATAGG - Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120985694 14:90332344-90332366 TTAAATGAACATATTTATAAAGG + Intergenic
1121468519 14:94132281-94132303 CAAAAAGCTCATAATTATTTAGG - Intergenic
1121684542 14:95825501-95825523 CTAAATTCTTATATGTATTTTGG + Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1124144313 15:27109015-27109037 ACAAATGCTCATAATAATATAGG - Intronic
1125095889 15:35850819-35850841 CCAAATGCTCATCTTCACATAGG + Intergenic
1125203584 15:37125460-37125482 CTAGATGCTAATCTTTATTTTGG - Intergenic
1125772378 15:42178134-42178156 TTCAATGTTCATATTTATTTTGG - Intronic
1126396971 15:48228409-48228431 CTAAATACCCATATATGTATGGG - Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127600483 15:60530922-60530944 TTAAATCCTCATGCTTATATTGG - Intronic
1128172743 15:65527327-65527349 ATAAATGCTCTTAATTATCTTGG - Intergenic
1131091514 15:89628038-89628060 TTAAATGGTCTTATGTATATAGG - Exonic
1131219999 15:90575614-90575636 CTAAATTCTCATAGTTTGATTGG + Intronic
1131453657 15:92566408-92566430 CAAAATGCTCATAGAAATATGGG - Intergenic
1131655544 15:94454184-94454206 CTAAATGTTTAAATTTATAGTGG - Intronic
1131934233 15:97484551-97484573 CTAAACACACATGTTTATATTGG - Intergenic
1133988556 16:10687442-10687464 CTAAATACTCTTATTTAAACAGG - Intronic
1136938174 16:34495667-34495689 CTTATTGCACATATATATATAGG + Intergenic
1136961644 16:34852890-34852912 CTTATTGCACATATATATATAGG - Intergenic
1138700698 16:58859874-58859896 CTAAATGCAAATAAATATATTGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139091706 16:63656222-63656244 GTTAATGCTGAAATTTATATTGG + Intergenic
1140377721 16:74458296-74458318 CTAAACGTTAATATTTTTATTGG + Intronic
1143049189 17:4109300-4109322 GTAATTGCTCATGTTTCTATAGG - Intronic
1143957290 17:10681031-10681053 ATATATGTTTATATTTATATAGG + Exonic
1144026187 17:11278133-11278155 ATAACTGCTCATATTTACAGTGG - Intronic
1144123689 17:12181469-12181491 AAAAATTCTCAAATTTATATTGG + Intergenic
1146697799 17:34924059-34924081 CTCAATGCTAATATTTATTTAGG - Intergenic
1146960110 17:36967154-36967176 CTAAATCTTCATTTTTATAAAGG - Intronic
1148955314 17:51348940-51348962 ATAAAAGCAAATATTTATATAGG - Intergenic
1149722962 17:58864220-58864242 ATAACTGCTAATATTTATACAGG - Intronic
1150528274 17:65947842-65947864 GAAAATGCTTCTATTTATATTGG + Intronic
1150957532 17:69876863-69876885 GTGAATCCTCAAATTTATATGGG + Intergenic
1151645579 17:75428841-75428863 CCAAATGCTCATGTTAATTTGGG - Intergenic
1153194315 18:2576689-2576711 AGAAATGCTCATATTTTGATTGG + Intronic
1154515568 18:15161591-15161613 CTTATTGCCCATATATATATAGG + Intergenic
1155370382 18:25093591-25093613 CTAAAGACTCATACTTGTATGGG - Intronic
1155803661 18:30140158-30140180 GTAAATGCTCATATCTATGTTGG - Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156525514 18:37764089-37764111 GAAAATGATCATATTTGTATAGG - Intergenic
1157891781 18:51425031-51425053 ATATATGCTCTTATTTATTTAGG + Intergenic
1158885717 18:61825321-61825343 CCAATTGATCATATATATATAGG + Intronic
1159081284 18:63738912-63738934 CCAGATGCTCATATTTATAACGG + Intergenic
1159141685 18:64403597-64403619 ATCAATGCTTATATTAATATTGG - Intergenic
1159419491 18:68198606-68198628 GAAAATGCTCAAATCTATATAGG - Intergenic
1162220870 19:9175026-9175048 CTAAATTCTCATATGGATGTTGG - Intergenic
1164880271 19:31727133-31727155 CTAAATGCACAAATATTTATAGG + Intergenic
1165638805 19:37366575-37366597 CAAAATGCTCATATATGGATGGG - Intronic
1166628505 19:44383748-44383770 TGACATGCTCATATTTATTTAGG + Exonic
1168388551 19:55987007-55987029 CTAAAACCTCATATTTACTTGGG + Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925700351 2:6630483-6630505 CTAAAGGCTCTTATTTCTAGTGG + Intergenic
927110198 2:19859064-19859086 CCAAATGCTGATCTTTATTTGGG + Intergenic
927527007 2:23753566-23753588 ATAGAAGCTCATATTTATACAGG + Intronic
928708484 2:33977884-33977906 CTAAAAGCTCTTGTTTTTATGGG - Intergenic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929974413 2:46617564-46617586 TTAACTGCACATTTTTATATGGG - Intronic
930566842 2:53031713-53031735 CTCAATGATCATATTTAAAAAGG - Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
931274166 2:60729621-60729643 CTAAAGACTCATATTAAAATAGG - Intergenic
936046329 2:109190924-109190946 CTAGATGCCAATATTTTTATGGG + Intronic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
938515831 2:132006380-132006402 CTTATTGCACATATATATATAGG + Intergenic
938545099 2:132321387-132321409 TGACATGCTCATATTTATTTAGG - Intergenic
939894848 2:147778880-147778902 TGAAATGGTCATATTCATATAGG - Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941689281 2:168481801-168481823 ATAGATGTTCATATTTACATAGG - Intronic
942331741 2:174832422-174832444 TTAAATGCTTATATTTAGAAAGG - Intronic
942549300 2:177097944-177097966 CTAAATGTTCCTCTTTACATTGG + Intergenic
943869299 2:192973631-192973653 TAAACTGCTCATAATTATATTGG + Intergenic
943938476 2:193958508-193958530 ATAAATTCTACTATTTATATAGG - Intergenic
943961302 2:194266156-194266178 CTAAATTGTCATCTTTAAATTGG + Intergenic
944169534 2:196759636-196759658 AAAAATGCTCATATATATACTGG - Intronic
944343510 2:198632492-198632514 CTTAATGTTCCTATTTATATAGG - Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
947129975 2:226911709-226911731 ATAAATGTTCATATTTAAAATGG + Intronic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
1169944142 20:10971038-10971060 ATAAATGCTCATTTCTGTATGGG - Intergenic
1170288873 20:14745317-14745339 CTAAATGTCTATATTTGTATAGG + Intronic
1170396666 20:15933092-15933114 ATAAATGCACTTATTTATGTAGG + Intronic
1171873959 20:30554170-30554192 TGACATGCTCATATTTATTTAGG - Intergenic
1172267562 20:33629939-33629961 CTAAAGGCTGACATTTATTTTGG - Intronic
1174727015 20:52873205-52873227 CTAAAAGCTGATATGTCTATTGG + Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1176777958 21:13156561-13156583 CTTATTGCCCATATATATATAGG - Intergenic
1177521391 21:22232610-22232632 GTAAATGCTCAAACTTGTATAGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177799403 21:25812997-25813019 GAAGATGCTCATATTTATTTAGG + Intergenic
1177992730 21:28058182-28058204 CTAAATGCTGACAATGATATGGG + Intergenic
1179005980 21:37515434-37515456 CAAAATGCTCATATTTTAGTTGG + Intronic
1179008732 21:37536793-37536815 CTAAATGCTCATTTTTCCTTAGG - Intergenic
1179225693 21:39451150-39451172 ATACATGTTAATATTTATATAGG - Intronic
1181505233 22:23351637-23351659 TTAATTGCTCATAGTGATATAGG - Intergenic
949389818 3:3547163-3547185 CTGAATTCTCATATTTCTATGGG + Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951118760 3:18897924-18897946 CTAAATGCAGATATTAAAATAGG - Intergenic
951765897 3:26198564-26198586 CTAAATTCTCTTATTTTTATTGG - Intergenic
952089337 3:29865237-29865259 CTATAGGCTCATATTTCCATAGG - Intronic
953089400 3:39708642-39708664 ATATATGCTCATCTTTGTATTGG + Intergenic
955545383 3:60023053-60023075 CAACATGCTCATTTTCATATTGG - Intronic
956135340 3:66092986-66093008 CAAAATGTTCATTTTTATAATGG - Intergenic
956953167 3:74305897-74305919 CTAAATGCTCAGCTTTCAATAGG + Intronic
957196961 3:77081216-77081238 GTAAATGCTTGTACTTATATTGG + Intronic
957251159 3:77772558-77772580 ATATATGCACATATATATATAGG - Intergenic
957399583 3:79691630-79691652 CCAAATACTTACATTTATATTGG - Intronic
957618119 3:82558854-82558876 CTATATCCACATATTAATATTGG + Intergenic
957882975 3:86246124-86246146 ATAAATGCAAATATGTATATAGG - Intergenic
958009370 3:87856750-87856772 CTGAATGCACATATTTACATGGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959137252 3:102438924-102438946 TTAAATGCTAATATTTATTTAGG + Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963131369 3:141861298-141861320 GGAAATGCTCATATATATTTTGG - Intergenic
963687091 3:148449929-148449951 CTACATGCTCTCATTTATAAGGG + Intergenic
963702554 3:148644387-148644409 ATAGATGCTCAGATCTATATAGG + Intergenic
964629705 3:158797202-158797224 CTAAATTCCCATATGTATTTGGG - Intronic
965020769 3:163227626-163227648 CCAAATGCAAATATATATATAGG - Intergenic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
965868118 3:173230833-173230855 CTAAGTGTACATATTTATAAAGG - Intergenic
966429811 3:179819642-179819664 TGAAATGCTCTTATTTTTATCGG - Intronic
966504327 3:180682198-180682220 CTATATGATTATATTTATGTAGG - Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969932486 4:10644302-10644324 ATGACTGCTCATATTTATTTAGG + Intronic
970219099 4:13790245-13790267 CCAAATGCCCATATTCATAAAGG + Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971031163 4:22638279-22638301 CTAAAAGCTTATATTTAAAGTGG - Intergenic
972817658 4:42661540-42661562 CTCATTGCTCATTTTTAAATTGG - Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
972903749 4:43718616-43718638 CAAAATGCTCTCATTTATAAGGG + Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973819556 4:54651119-54651141 TTAAATACTCATATATACATTGG + Intergenic
974398772 4:61373433-61373455 TTAAATTCTCAAATTCATATGGG - Intronic
974477572 4:62403807-62403829 TTAAATGGTCAACTTTATATGGG + Intergenic
974635262 4:64556055-64556077 CTAAGTGCTAACATATATATAGG + Intergenic
974676660 4:65099330-65099352 ACAAATGGTGATATTTATATTGG - Intergenic
974680321 4:65152468-65152490 CTAGATGCTTCTTTTTATATAGG + Intergenic
974807040 4:66894218-66894240 TTAAATGCTCTTTTTTATGTGGG - Intergenic
975569349 4:75797388-75797410 TTAAATTCTCATTTGTATATGGG + Intronic
975786646 4:77897021-77897043 CTAAATGCTAATTTATAAATAGG - Intronic
976865153 4:89716616-89716638 AAAACTGCTCATATTTAAATGGG + Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977964034 4:103121912-103121934 CTAAATTCTCATACTTAATTGGG + Intronic
978592061 4:110334950-110334972 ATAAATCCTCACATTTATTTGGG - Intergenic
979326630 4:119387560-119387582 CTAAAAGCTCATCTGTAAATCGG - Intergenic
979936879 4:126709345-126709367 CTATAGGCTTATATTTAAATAGG + Intergenic
980265740 4:130513149-130513171 CTGAATGCCCATATTTGTAATGG + Intergenic
980618015 4:135258800-135258822 TTCAAGGCTCATTTTTATATTGG + Intergenic
980785473 4:137548519-137548541 ACAAATGATCATATTAATATAGG - Intergenic
980789331 4:137599184-137599206 ATAGAATCTCATATTTATATAGG - Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
983244499 4:165272209-165272231 CTAAAAGCTCATCTGTAAATCGG - Intronic
983440966 4:167783751-167783773 CTAAATGCCCATCTTTCTCTGGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984343123 4:178484441-178484463 CTAAAAGAACATATTTATTTGGG - Intergenic
984595951 4:181668122-181668144 GTAAATGCTCAAATATTTATTGG + Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986102706 5:4628815-4628837 CCAGATGTTCATATTTATTTTGG + Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986816407 5:11417057-11417079 CTAATAGCTAATATTTATATAGG + Intronic
987579323 5:19768578-19768600 GTAAATGTTAATATATATATTGG + Intronic
987867375 5:23563048-23563070 CTAAATTTCCATATTTTTATGGG - Intergenic
987959277 5:24783919-24783941 CTTAATGGTTATATTTATTTTGG - Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988256976 5:28832963-28832985 ATAAATACTTATAATTATATAGG + Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988805641 5:34738046-34738068 CTGTCTGCTCATATTTATAGAGG + Intronic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
992866792 5:80964839-80964861 CTAAATGCAAATATTTTTAAAGG - Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993604581 5:89972813-89972835 CAAAATGCTCTTATTTATTGGGG + Intergenic
994123023 5:96138289-96138311 TAAAATGATCATATTTATGTAGG + Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994810847 5:104518124-104518146 TTATTTGCTCATTTTTATATTGG + Intergenic
996020417 5:118585389-118585411 CAAATTATTCATATTTATATTGG - Intergenic
996185493 5:120468680-120468702 TTAAATGCTGGTATTAATATGGG + Intronic
996205358 5:120728245-120728267 CTTAATGCTTATAATTATTTGGG - Intergenic
997369938 5:133353121-133353143 CTAAATTCTCATCTTTATACTGG - Intronic
997468003 5:134100949-134100971 CTCCATGCTCATATTTTTCTTGG + Intergenic
997688846 5:135811778-135811800 CTAAATACTCATATTTAAACAGG - Intergenic
998047489 5:139000445-139000467 CTGAATTCTCTTATTTGTATTGG - Intronic
998701493 5:144706188-144706210 ATAAAAACTCATATTTTTATTGG - Intergenic
1000181840 5:158819158-158819180 TTAAATGCTCATTTTTTTAAAGG - Intronic
1000524716 5:162342922-162342944 CTAGATGTTCATTTTTTTATGGG - Intergenic
1000683097 5:164211276-164211298 TTAAAGGCTCTTATTTATAATGG - Intergenic
1000774539 5:165402699-165402721 CTAAATGTTATTATATATATAGG - Intergenic
1003768708 6:9272102-9272124 TAAAATGTTCATATTTATAAGGG - Intergenic
1004064278 6:12227710-12227732 CAAGATGGTAATATTTATATCGG + Intergenic
1007147917 6:39655713-39655735 CTAAGTTCTCATATATACATGGG + Intronic
1007466782 6:42057962-42057984 CTAAATGTTCATAGTAATTTTGG + Intronic
1007531063 6:42542924-42542946 TTAAATCCTCATTTGTATATGGG - Intergenic
1008058798 6:46974684-46974706 CTGAATGGCCATATTTAAATGGG - Intergenic
1008689192 6:53958615-53958637 CTAGATGCTCATAGTTCTGTAGG + Intronic
1008739780 6:54592445-54592467 TTAAATTCTCATATCTATATTGG - Intergenic
1008778712 6:55073851-55073873 CTAAAGGCTCTTATAGATATAGG + Intergenic
1008895646 6:56551710-56551732 CTAAAAGCTCATATTTTTAAAGG - Intronic
1008920183 6:56835418-56835440 ATAGTTTCTCATATTTATATCGG - Intronic
1009555886 6:65165991-65166013 ATAAAGGCTAATATTTATAATGG + Intronic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009821003 6:68801121-68801143 CTTGATGCTCATATATATAATGG + Intronic
1009905048 6:69859910-69859932 CTTAATGCTCATAGTTCTAGGGG + Intergenic
1010315912 6:74450194-74450216 CTACATGCCTATTTTTATATTGG + Intergenic
1010330059 6:74613184-74613206 CCAAATGCTTATATCTCTATAGG + Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010736410 6:79448865-79448887 CTAAATTCTTGTATTTTTATTGG + Intergenic
1010875158 6:81094741-81094763 TTATATGCTGATAGTTATATTGG + Intergenic
1012632593 6:101490809-101490831 CAAAATCCTCAGATTAATATAGG + Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1012850563 6:104441983-104442005 CTAAATTCTTCTCTTTATATAGG + Intergenic
1013846309 6:114456572-114456594 TTAAATTCTCATATCTATAGAGG - Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1013988604 6:116226925-116226947 CTAAATGATACTATTTAAATAGG + Intronic
1014230427 6:118896073-118896095 ATAAATGCACATACATATATAGG + Intronic
1014239567 6:119000537-119000559 TTTAATGCTCATTTTTAGATAGG + Intronic
1014249517 6:119100992-119101014 CTATATCCTCATGTTTTTATAGG + Intronic
1014959285 6:127662437-127662459 CTAAATGTTCATATGTATTTGGG - Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015855515 6:137620273-137620295 CCAGTTGGTCATATTTATATGGG - Intergenic
1016639303 6:146330530-146330552 CTAAATTTTCAATTTTATATTGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020642356 7:10771182-10771204 CTCAATGCTTTTATTTCTATGGG + Intergenic
1020688560 7:11326452-11326474 CTGAATGCACAATTTTATATAGG + Intergenic
1020950077 7:14664443-14664465 ATTTAAGCTCATATTTATATTGG + Intronic
1021718408 7:23482964-23482986 CTATATTTGCATATTTATATCGG - Intergenic
1022926804 7:35064178-35064200 CTAAATGCTCATATTAGAAAAGG - Intergenic
1023498733 7:40825876-40825898 CTACATGCCCGTATTTATAAAGG + Intronic
1025321917 7:58103610-58103632 CTTATTGCACATATATATATAGG - Intergenic
1027553086 7:79623663-79623685 TTAATTGGTCATATTTATAAAGG + Intergenic
1031264199 7:119564002-119564024 CTTCATGCTCATATTTTTGTAGG - Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1032378794 7:131453357-131453379 CTAAATTCTCATATGTATTTGGG - Intronic
1032627874 7:133612345-133612367 TTAAATGATCTTATTTATATTGG + Intronic
1032771400 7:135061695-135061717 ATAAATGCACAGATTTATTTTGG + Intronic
1033044444 7:137948600-137948622 TTAAATGCTAATATTTACCTTGG - Intronic
1033396852 7:140982969-140982991 CTAAAATGTCATTTTTATATAGG - Intergenic
1033590874 7:142807210-142807232 TTAAATGCTCATATTCACAGAGG - Intergenic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1035490500 7:159272424-159272446 CTAAGTCCTCAGGTTTATATGGG - Intergenic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1036966564 8:13305412-13305434 CAAAATGCTAATTTTTCTATTGG - Intronic
1039075812 8:33689630-33689652 CTAAGGGCTCATGTTTATATGGG - Intergenic
1039157702 8:34580097-34580119 CTAAAGACTCATTTTTATCTAGG + Intergenic
1040923812 8:52654204-52654226 CTAAATGCTGAGTTTTAAATGGG + Intronic
1042784125 8:72527785-72527807 CTAAATCCACAAATTTATTTAGG + Intergenic
1043051528 8:75391952-75391974 CTTAATGCTCATAGTTATACAGG + Intergenic
1043664900 8:82797735-82797757 ATAAATACACATATATATATGGG - Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1045352389 8:101353769-101353791 CTAAATGTATATATGTATATTGG + Intergenic
1045427523 8:102081890-102081912 CTAATAGCTCATATTTACACCGG - Intronic
1047066817 8:121293195-121293217 CCCAATACTCATTTTTATATTGG - Intergenic
1047855399 8:128904043-128904065 CTAGATGTTCATAGTTACATGGG + Intergenic
1047900232 8:129412897-129412919 CTTAACACTCATATTTATACTGG + Intergenic
1050468219 9:5955466-5955488 CAAGATGATTATATTTATATAGG - Intronic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050818330 9:9844360-9844382 CTACATGATCTAATTTATATAGG + Intronic
1051968332 9:22857003-22857025 TTAGATGCTCATATTATTATGGG - Intergenic
1053388321 9:37713635-37713657 ATAAATGGTCATATATATATAGG - Intronic
1053946649 9:43316013-43316035 CTTATTGCACATATATATATAGG - Intergenic
1055152231 9:73015751-73015773 CTAAATGCAAATATTTAGATTGG + Intronic
1055206045 9:73731777-73731799 CTATAGGTTTATATTTATATAGG - Intergenic
1056914766 9:90736505-90736527 ATTAATGTTTATATTTATATAGG - Intergenic
1058634744 9:107025507-107025529 CTAAATGCGCCTATTTAGTTGGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059570175 9:115425833-115425855 CTAACTGCTGATAATGATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1060099081 9:120822215-120822237 CTACATGCTTATTTTTGTATTGG - Intronic
1203589779 Un_KI270747v1:44571-44593 CTTATTGCACATATATATATAGG - Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186060782 X:5703927-5703949 CAAAAAGCTCACAATTATATGGG + Intergenic
1186553363 X:10530689-10530711 CTAAAGGCTCATATTGAGATTGG - Intronic
1188302783 X:28526182-28526204 CTAAATGCTCATATAGAAATTGG + Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191830496 X:65409955-65409977 AAAAATGCTAAAATTTATATAGG + Intronic
1191995015 X:67084647-67084669 ATAAATCCTCAAATTTGTATGGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192732163 X:73811336-73811358 CTAAATGCTTAAATTTTTAAAGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193628088 X:83844291-83844313 CTAAATGCTGATAAAAATATGGG - Intergenic
1193862432 X:86686584-86686606 TTAAATTGTCATATTTATCTTGG - Intronic
1194181965 X:90722040-90722062 CTAAATATTTATATTTTTATTGG + Intergenic
1195114896 X:101687477-101687499 ATAATAGCTAATATTTATATGGG - Intergenic
1195230773 X:102844747-102844769 CTAAATGATGATATTATTATAGG + Intergenic
1195316360 X:103683012-103683034 CTAAATTCTCAGAGGTATATGGG + Intronic
1197204157 X:123775236-123775258 CTAAATGTTGATATGAATATAGG - Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197899200 X:131351364-131351386 TTAAATGTCCATATTTGTATGGG - Intronic
1199156840 X:144559771-144559793 CTAAATGGTGTTATTGATATGGG - Intergenic
1199587626 X:149432788-149432810 CTATCTGCTCGTCTTTATATTGG + Intergenic
1200528592 Y:4303950-4303972 CTAAATATTTATATTTTTATTGG + Intergenic
1200874838 Y:8142760-8142782 CTATATGCACATATTTGTTTGGG + Intergenic
1202101818 Y:21317170-21317192 CTATATGCACATATTTGTTTGGG + Intergenic