ID: 1071327418

View in Genome Browser
Species Human (GRCh38)
Location 10:84530674-84530696
Sequence TGGCAAATGGCAGTTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071327411_1071327418 13 Left 1071327411 10:84530638-84530660 CCAGAGGGGTGGAAGTCAGCGGC 0: 21
1: 71
2: 115
3: 97
4: 145
Right 1071327418 10:84530674-84530696 TGGCAAATGGCAGTTGTGGATGG No data
1071327408_1071327418 23 Left 1071327408 10:84530628-84530650 CCTGCCAGATCCAGAGGGGTGGA 0: 10
1: 48
2: 85
3: 148
4: 393
Right 1071327418 10:84530674-84530696 TGGCAAATGGCAGTTGTGGATGG No data
1071327406_1071327418 24 Left 1071327406 10:84530627-84530649 CCCTGCCAGATCCAGAGGGGTGG 0: 10
1: 46
2: 99
3: 132
4: 299
Right 1071327418 10:84530674-84530696 TGGCAAATGGCAGTTGTGGATGG No data
1071327409_1071327418 19 Left 1071327409 10:84530632-84530654 CCAGATCCAGAGGGGTGGAAGTC 0: 28
1: 72
2: 82
3: 94
4: 145
Right 1071327418 10:84530674-84530696 TGGCAAATGGCAGTTGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071327418 Original CRISPR TGGCAAATGGCAGTTGTGGA TGG Intergenic
No off target data available for this crispr