ID: 1071328230

View in Genome Browser
Species Human (GRCh38)
Location 10:84537321-84537343
Sequence CTGCACTTACAGCTATTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071328226_1071328230 27 Left 1071328226 10:84537271-84537293 CCTCACTATTTTACAGAGGAGAA No data
Right 1071328230 10:84537321-84537343 CTGCACTTACAGCTATTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071328230 Original CRISPR CTGCACTTACAGCTATTAAA TGG Intergenic
No off target data available for this crispr