ID: 1071328255

View in Genome Browser
Species Human (GRCh38)
Location 10:84537554-84537576
Sequence TAGTGGGGAGGGCCGGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071328240_1071328255 21 Left 1071328240 10:84537510-84537532 CCCAAGTCATAGAGCTATTAAAG No data
Right 1071328255 10:84537554-84537576 TAGTGGGGAGGGCCGGCGGGAGG No data
1071328241_1071328255 20 Left 1071328241 10:84537511-84537533 CCAAGTCATAGAGCTATTAAAGG No data
Right 1071328255 10:84537554-84537576 TAGTGGGGAGGGCCGGCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071328255 Original CRISPR TAGTGGGGAGGGCCGGCGGG AGG Intergenic
No off target data available for this crispr