ID: 1071329217

View in Genome Browser
Species Human (GRCh38)
Location 10:84543713-84543735
Sequence AGGGGCCCAAAGTTGAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071329212_1071329217 3 Left 1071329212 10:84543687-84543709 CCTGGGAGGAGGCCGATCATACT No data
Right 1071329217 10:84543713-84543735 AGGGGCCCAAAGTTGAAGATAGG No data
1071329216_1071329217 -9 Left 1071329216 10:84543699-84543721 CCGATCATACTTTAAGGGGCCCA No data
Right 1071329217 10:84543713-84543735 AGGGGCCCAAAGTTGAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071329217 Original CRISPR AGGGGCCCAAAGTTGAAGAT AGG Intergenic
No off target data available for this crispr