ID: 1071332771

View in Genome Browser
Species Human (GRCh38)
Location 10:84576231-84576253
Sequence ATGGAGAAGAAAAACGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071332771_1071332779 19 Left 1071332771 10:84576231-84576253 CCCTCCTCGTTTTTCTTCTCCAT No data
Right 1071332779 10:84576273-84576295 CTTTCTTTCTCTTAGCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071332771 Original CRISPR ATGGAGAAGAAAAACGAGGA GGG (reversed) Intergenic
No off target data available for this crispr