ID: 1071334855

View in Genome Browser
Species Human (GRCh38)
Location 10:84592000-84592022
Sequence TATGGAGCACCTCCCAAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071334855_1071334857 1 Left 1071334855 10:84592000-84592022 CCACTCTTGGGAGGTGCTCCATA No data
Right 1071334857 10:84592024-84592046 ATAGTGAATTTGTTAAACACTGG No data
1071334855_1071334858 12 Left 1071334855 10:84592000-84592022 CCACTCTTGGGAGGTGCTCCATA No data
Right 1071334858 10:84592035-84592057 GTTAAACACTGGAAGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071334855 Original CRISPR TATGGAGCACCTCCCAAGAG TGG (reversed) Intergenic
No off target data available for this crispr