ID: 1071341605

View in Genome Browser
Species Human (GRCh38)
Location 10:84653851-84653873
Sequence CACGCCCAGCTAATATTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071341597_1071341605 18 Left 1071341597 10:84653810-84653832 CCTCAGCCTGCCGAGTAGCTGGG 0: 654
1: 102808
2: 286483
3: 227194
4: 125496
Right 1071341605 10:84653851-84653873 CACGCCCAGCTAATATTTTGTGG No data
1071341599_1071341605 12 Left 1071341599 10:84653816-84653838 CCTGCCGAGTAGCTGGGACCAGA No data
Right 1071341605 10:84653851-84653873 CACGCCCAGCTAATATTTTGTGG No data
1071341595_1071341605 22 Left 1071341595 10:84653806-84653828 CCTACCTCAGCCTGCCGAGTAGC 0: 56
1: 7325
2: 132351
3: 288521
4: 197350
Right 1071341605 10:84653851-84653873 CACGCCCAGCTAATATTTTGTGG No data
1071341602_1071341605 -6 Left 1071341602 10:84653834-84653856 CCAGAGGTGTGCGCCACCACGCC No data
Right 1071341605 10:84653851-84653873 CACGCCCAGCTAATATTTTGTGG No data
1071341601_1071341605 8 Left 1071341601 10:84653820-84653842 CCGAGTAGCTGGGACCAGAGGTG 0: 37
1: 2970
2: 36328
3: 113548
4: 136655
Right 1071341605 10:84653851-84653873 CACGCCCAGCTAATATTTTGTGG No data
1071341594_1071341605 25 Left 1071341594 10:84653803-84653825 CCTCCTACCTCAGCCTGCCGAGT No data
Right 1071341605 10:84653851-84653873 CACGCCCAGCTAATATTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071341605 Original CRISPR CACGCCCAGCTAATATTTTG TGG Intergenic
No off target data available for this crispr