ID: 1071343803

View in Genome Browser
Species Human (GRCh38)
Location 10:84672358-84672380
Sequence CAACCAGGAATTAAGATAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071343803_1071343805 -10 Left 1071343803 10:84672358-84672380 CCAATTATCTTAATTCCTGGTTG No data
Right 1071343805 10:84672371-84672393 TTCCTGGTTGGATTAGATGCTGG No data
1071343803_1071343807 18 Left 1071343803 10:84672358-84672380 CCAATTATCTTAATTCCTGGTTG No data
Right 1071343807 10:84672399-84672421 TGAATTTTCAAAAGCATTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071343803 Original CRISPR CAACCAGGAATTAAGATAAT TGG (reversed) Intergenic
No off target data available for this crispr