ID: 1071353561

View in Genome Browser
Species Human (GRCh38)
Location 10:84770314-84770336
Sequence CTATTGATGTGGCACCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071353561_1071353566 -9 Left 1071353561 10:84770314-84770336 CCCCCTGGGTGCCACATCAATAG No data
Right 1071353566 10:84770328-84770350 CATCAATAGCACCATCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071353561 Original CRISPR CTATTGATGTGGCACCCAGG GGG (reversed) Intergenic
No off target data available for this crispr