ID: 1071356061

View in Genome Browser
Species Human (GRCh38)
Location 10:84797411-84797433
Sequence CTGGGAGTGCACCTTGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071356057_1071356061 2 Left 1071356057 10:84797386-84797408 CCCAAGTCAAAGCAAATGATTCT No data
Right 1071356061 10:84797411-84797433 CTGGGAGTGCACCTTGATTCTGG No data
1071356056_1071356061 25 Left 1071356056 10:84797363-84797385 CCAAAGTGGAGATCAGGAGATCT No data
Right 1071356061 10:84797411-84797433 CTGGGAGTGCACCTTGATTCTGG No data
1071356058_1071356061 1 Left 1071356058 10:84797387-84797409 CCAAGTCAAAGCAAATGATTCTT No data
Right 1071356061 10:84797411-84797433 CTGGGAGTGCACCTTGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071356061 Original CRISPR CTGGGAGTGCACCTTGATTC TGG Intergenic
No off target data available for this crispr