ID: 1071357260

View in Genome Browser
Species Human (GRCh38)
Location 10:84810610-84810632
Sequence TGGGACTCCTTGGAAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071357260_1071357266 0 Left 1071357260 10:84810610-84810632 CCTGTTTTTTCCAAGGAGTCCCA No data
Right 1071357266 10:84810633-84810655 GGCTACCAGAAGTCATCTTAGGG No data
1071357260_1071357270 26 Left 1071357260 10:84810610-84810632 CCTGTTTTTTCCAAGGAGTCCCA No data
Right 1071357270 10:84810659-84810681 CTTATGTATGCATTAAGATTGGG No data
1071357260_1071357269 25 Left 1071357260 10:84810610-84810632 CCTGTTTTTTCCAAGGAGTCCCA No data
Right 1071357269 10:84810658-84810680 TCTTATGTATGCATTAAGATTGG No data
1071357260_1071357265 -1 Left 1071357260 10:84810610-84810632 CCTGTTTTTTCCAAGGAGTCCCA No data
Right 1071357265 10:84810632-84810654 AGGCTACCAGAAGTCATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071357260 Original CRISPR TGGGACTCCTTGGAAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr