ID: 1071359062

View in Genome Browser
Species Human (GRCh38)
Location 10:84827623-84827645
Sequence TTTCAAGTGCAGGCCCTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071359054_1071359062 0 Left 1071359054 10:84827600-84827622 CCTTGCCAGGGCCCTGCCAAAAC No data
Right 1071359062 10:84827623-84827645 TTTCAAGTGCAGGCCCTGAGGGG No data
1071359055_1071359062 -5 Left 1071359055 10:84827605-84827627 CCAGGGCCCTGCCAAAACTTTCA No data
Right 1071359062 10:84827623-84827645 TTTCAAGTGCAGGCCCTGAGGGG No data
1071359050_1071359062 19 Left 1071359050 10:84827581-84827603 CCTCTGCATTCCTGGAGCACCTT No data
Right 1071359062 10:84827623-84827645 TTTCAAGTGCAGGCCCTGAGGGG No data
1071359053_1071359062 9 Left 1071359053 10:84827591-84827613 CCTGGAGCACCTTGCCAGGGCCC No data
Right 1071359062 10:84827623-84827645 TTTCAAGTGCAGGCCCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071359062 Original CRISPR TTTCAAGTGCAGGCCCTGAG GGG Intergenic
No off target data available for this crispr