ID: 1071359164

View in Genome Browser
Species Human (GRCh38)
Location 10:84828515-84828537
Sequence GCCCTCACACATCACATTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071359164_1071359171 14 Left 1071359164 10:84828515-84828537 CCAACAATGTGATGTGTGAGGGC No data
Right 1071359171 10:84828552-84828574 TATCAGTCAATCTCTGGAGGGGG No data
1071359164_1071359170 13 Left 1071359164 10:84828515-84828537 CCAACAATGTGATGTGTGAGGGC No data
Right 1071359170 10:84828551-84828573 GTATCAGTCAATCTCTGGAGGGG No data
1071359164_1071359167 8 Left 1071359164 10:84828515-84828537 CCAACAATGTGATGTGTGAGGGC No data
Right 1071359167 10:84828546-84828568 ATGCAGTATCAGTCAATCTCTGG No data
1071359164_1071359168 11 Left 1071359164 10:84828515-84828537 CCAACAATGTGATGTGTGAGGGC No data
Right 1071359168 10:84828549-84828571 CAGTATCAGTCAATCTCTGGAGG No data
1071359164_1071359172 19 Left 1071359164 10:84828515-84828537 CCAACAATGTGATGTGTGAGGGC No data
Right 1071359172 10:84828557-84828579 GTCAATCTCTGGAGGGGGACAGG No data
1071359164_1071359169 12 Left 1071359164 10:84828515-84828537 CCAACAATGTGATGTGTGAGGGC No data
Right 1071359169 10:84828550-84828572 AGTATCAGTCAATCTCTGGAGGG No data
1071359164_1071359173 22 Left 1071359164 10:84828515-84828537 CCAACAATGTGATGTGTGAGGGC No data
Right 1071359173 10:84828560-84828582 AATCTCTGGAGGGGGACAGGAGG No data
1071359164_1071359174 28 Left 1071359164 10:84828515-84828537 CCAACAATGTGATGTGTGAGGGC No data
Right 1071359174 10:84828566-84828588 TGGAGGGGGACAGGAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071359164 Original CRISPR GCCCTCACACATCACATTGT TGG (reversed) Intergenic
No off target data available for this crispr