ID: 1071365989

View in Genome Browser
Species Human (GRCh38)
Location 10:84901119-84901141
Sequence CTCTCTTTGCCTCTGGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071365983_1071365989 14 Left 1071365983 10:84901082-84901104 CCCCAAGATGATGATCTATAGGG No data
Right 1071365989 10:84901119-84901141 CTCTCTTTGCCTCTGGCTTCTGG No data
1071365985_1071365989 13 Left 1071365985 10:84901083-84901105 CCCAAGATGATGATCTATAGGGA No data
Right 1071365989 10:84901119-84901141 CTCTCTTTGCCTCTGGCTTCTGG No data
1071365986_1071365989 12 Left 1071365986 10:84901084-84901106 CCAAGATGATGATCTATAGGGAG No data
Right 1071365989 10:84901119-84901141 CTCTCTTTGCCTCTGGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071365989 Original CRISPR CTCTCTTTGCCTCTGGCTTC TGG Intergenic
No off target data available for this crispr