ID: 1071371446

View in Genome Browser
Species Human (GRCh38)
Location 10:84955657-84955679
Sequence TTTACTCTGGATTTGGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071371443_1071371446 -6 Left 1071371443 10:84955640-84955662 CCTACAAGAAAAAGAGGTTTACT No data
Right 1071371446 10:84955657-84955679 TTTACTCTGGATTTGGCCTGAGG No data
1071371442_1071371446 -5 Left 1071371442 10:84955639-84955661 CCCTACAAGAAAAAGAGGTTTAC No data
Right 1071371446 10:84955657-84955679 TTTACTCTGGATTTGGCCTGAGG No data
1071371439_1071371446 23 Left 1071371439 10:84955611-84955633 CCGGCTTTGGAGACCTGCTTTTT No data
Right 1071371446 10:84955657-84955679 TTTACTCTGGATTTGGCCTGAGG No data
1071371440_1071371446 10 Left 1071371440 10:84955624-84955646 CCTGCTTTTTCTCAGCCCTACAA No data
Right 1071371446 10:84955657-84955679 TTTACTCTGGATTTGGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071371446 Original CRISPR TTTACTCTGGATTTGGCCTG AGG Intergenic
No off target data available for this crispr