ID: 1071371897

View in Genome Browser
Species Human (GRCh38)
Location 10:84959927-84959949
Sequence GTTTTTAAGGGGTTTGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071371897_1071371907 13 Left 1071371897 10:84959927-84959949 CCCACTCCAAACCCCTTAAAAAC No data
Right 1071371907 10:84959963-84959985 TCCTTAAGGAGATGAAGTTGAGG No data
1071371897_1071371903 -1 Left 1071371897 10:84959927-84959949 CCCACTCCAAACCCCTTAAAAAC No data
Right 1071371903 10:84959949-84959971 CTCTAGCCCCGAACTCCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071371897 Original CRISPR GTTTTTAAGGGGTTTGGAGT GGG (reversed) Intergenic
No off target data available for this crispr