ID: 1071372491

View in Genome Browser
Species Human (GRCh38)
Location 10:84966565-84966587
Sequence GGTTCAGGTGTGCGCGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071372483_1071372491 20 Left 1071372483 10:84966522-84966544 CCTTTCTCTCAGGTGTGGGTCTG No data
Right 1071372491 10:84966565-84966587 GGTTCAGGTGTGCGCGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071372491 Original CRISPR GGTTCAGGTGTGCGCGTTGC TGG Intergenic