ID: 1071379891

View in Genome Browser
Species Human (GRCh38)
Location 10:85048021-85048043
Sequence CTCTGTATAAAGCTGAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071379889_1071379891 3 Left 1071379889 10:85047995-85048017 CCATGCTTTCTCTGGGTCTCCAA No data
Right 1071379891 10:85048021-85048043 CTCTGTATAAAGCTGAAGCTAGG No data
1071379888_1071379891 4 Left 1071379888 10:85047994-85048016 CCCATGCTTTCTCTGGGTCTCCA No data
Right 1071379891 10:85048021-85048043 CTCTGTATAAAGCTGAAGCTAGG No data
1071379887_1071379891 5 Left 1071379887 10:85047993-85048015 CCCCATGCTTTCTCTGGGTCTCC No data
Right 1071379891 10:85048021-85048043 CTCTGTATAAAGCTGAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071379891 Original CRISPR CTCTGTATAAAGCTGAAGCT AGG Intergenic
No off target data available for this crispr