ID: 1071381253

View in Genome Browser
Species Human (GRCh38)
Location 10:85062586-85062608
Sequence TCTTCTTCGTGTAGATCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071381253_1071381256 17 Left 1071381253 10:85062586-85062608 CCTTCTGATCTACACGAAGAAGA No data
Right 1071381256 10:85062626-85062648 AGGCTCTTTTCCTACCTACTAGG No data
1071381253_1071381257 21 Left 1071381253 10:85062586-85062608 CCTTCTGATCTACACGAAGAAGA No data
Right 1071381257 10:85062630-85062652 TCTTTTCCTACCTACTAGGTAGG No data
1071381253_1071381254 -3 Left 1071381253 10:85062586-85062608 CCTTCTGATCTACACGAAGAAGA No data
Right 1071381254 10:85062606-85062628 AGACTGATCCTACATTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071381253 Original CRISPR TCTTCTTCGTGTAGATCAGA AGG (reversed) Intergenic
No off target data available for this crispr