ID: 1071381585

View in Genome Browser
Species Human (GRCh38)
Location 10:85068591-85068613
Sequence GAGGGAGGTGAGGATGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071381577_1071381585 29 Left 1071381577 10:85068539-85068561 CCAAAGCTTAATCTAGAGCAAGG No data
Right 1071381585 10:85068591-85068613 GAGGGAGGTGAGGATGCTGCAGG No data
1071381579_1071381585 6 Left 1071381579 10:85068562-85068584 CCTTAACTTTCCTCAAGTCTATG No data
Right 1071381585 10:85068591-85068613 GAGGGAGGTGAGGATGCTGCAGG No data
1071381580_1071381585 -4 Left 1071381580 10:85068572-85068594 CCTCAAGTCTATGAATGCTGAGG No data
Right 1071381585 10:85068591-85068613 GAGGGAGGTGAGGATGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071381585 Original CRISPR GAGGGAGGTGAGGATGCTGC AGG Intergenic
No off target data available for this crispr