ID: 1071387303

View in Genome Browser
Species Human (GRCh38)
Location 10:85134318-85134340
Sequence GTGAACAAAACAAAGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071387303_1071387307 30 Left 1071387303 10:85134318-85134340 CCTTGCACCTTTGTTTTGTTCAC No data
Right 1071387307 10:85134371-85134393 CATTCTTCCTTCCACATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071387303 Original CRISPR GTGAACAAAACAAAGGTGCA AGG (reversed) Intergenic
No off target data available for this crispr