ID: 1071388925

View in Genome Browser
Species Human (GRCh38)
Location 10:85150379-85150401
Sequence TAGGAAAAAGAGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071388925_1071388933 7 Left 1071388925 10:85150379-85150401 CCTTCCTCCTCCTCTTTTTCCTA No data
Right 1071388933 10:85150409-85150431 TGCCTGACAGAAGAGATTGGGGG No data
1071388925_1071388931 5 Left 1071388925 10:85150379-85150401 CCTTCCTCCTCCTCTTTTTCCTA No data
Right 1071388931 10:85150407-85150429 TTTGCCTGACAGAAGAGATTGGG No data
1071388925_1071388932 6 Left 1071388925 10:85150379-85150401 CCTTCCTCCTCCTCTTTTTCCTA No data
Right 1071388932 10:85150408-85150430 TTGCCTGACAGAAGAGATTGGGG No data
1071388925_1071388930 4 Left 1071388925 10:85150379-85150401 CCTTCCTCCTCCTCTTTTTCCTA No data
Right 1071388930 10:85150406-85150428 TTTTGCCTGACAGAAGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071388925 Original CRISPR TAGGAAAAAGAGGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr