ID: 1071399050

View in Genome Browser
Species Human (GRCh38)
Location 10:85251551-85251573
Sequence TCACAGAAGGACAACAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071399050_1071399055 -6 Left 1071399050 10:85251551-85251573 CCCACACTGTTGTCCTTCTGTGA No data
Right 1071399055 10:85251568-85251590 CTGTGAGGTAATGCTGATGAGGG No data
1071399050_1071399054 -7 Left 1071399050 10:85251551-85251573 CCCACACTGTTGTCCTTCTGTGA No data
Right 1071399054 10:85251567-85251589 TCTGTGAGGTAATGCTGATGAGG No data
1071399050_1071399057 21 Left 1071399050 10:85251551-85251573 CCCACACTGTTGTCCTTCTGTGA No data
Right 1071399057 10:85251595-85251617 TATTTTTTTTAGTTTTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071399050 Original CRISPR TCACAGAAGGACAACAGTGT GGG (reversed) Intergenic
No off target data available for this crispr