ID: 1071399144

View in Genome Browser
Species Human (GRCh38)
Location 10:85252538-85252560
Sequence TACCTAAAGCAGCTACAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071399143_1071399144 4 Left 1071399143 10:85252511-85252533 CCGTTCTGAGGATCAAAATAAGC No data
Right 1071399144 10:85252538-85252560 TACCTAAAGCAGCTACAGACAGG No data
1071399142_1071399144 13 Left 1071399142 10:85252502-85252524 CCACATGGGCCGTTCTGAGGATC No data
Right 1071399144 10:85252538-85252560 TACCTAAAGCAGCTACAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071399144 Original CRISPR TACCTAAAGCAGCTACAGAC AGG Intergenic
No off target data available for this crispr