ID: 1071399531

View in Genome Browser
Species Human (GRCh38)
Location 10:85256060-85256082
Sequence AAGTTCTACAGAAGCTTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071399528_1071399531 19 Left 1071399528 10:85256018-85256040 CCTCAGGGGACTCACAGTACAGT No data
Right 1071399531 10:85256060-85256082 AAGTTCTACAGAAGCTTAGCTGG No data
1071399527_1071399531 28 Left 1071399527 10:85256009-85256031 CCTCAGGAACCTCAGGGGACTCA No data
Right 1071399531 10:85256060-85256082 AAGTTCTACAGAAGCTTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071399531 Original CRISPR AAGTTCTACAGAAGCTTAGC TGG Intergenic
No off target data available for this crispr