ID: 1071404598

View in Genome Browser
Species Human (GRCh38)
Location 10:85317984-85318006
Sequence CACTCTCTCCAGAGGCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071404591_1071404598 24 Left 1071404591 10:85317937-85317959 CCCAGAAAGGGTTTCAGTGGGTC No data
Right 1071404598 10:85317984-85318006 CACTCTCTCCAGAGGCTCTAGGG No data
1071404592_1071404598 23 Left 1071404592 10:85317938-85317960 CCAGAAAGGGTTTCAGTGGGTCG No data
Right 1071404598 10:85317984-85318006 CACTCTCTCCAGAGGCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071404598 Original CRISPR CACTCTCTCCAGAGGCTCTA GGG Intergenic
No off target data available for this crispr