ID: 1071410978

View in Genome Browser
Species Human (GRCh38)
Location 10:85394979-85395001
Sequence CTTTCTAGGGAGAGAAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071410978_1071410985 17 Left 1071410978 10:85394979-85395001 CCTGCCCTTCTCTCCCTAGAAAG No data
Right 1071410985 10:85395019-85395041 TAAGTATGTTCATATTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071410978 Original CRISPR CTTTCTAGGGAGAGAAGGGC AGG (reversed) Intergenic
No off target data available for this crispr