ID: 1071411420

View in Genome Browser
Species Human (GRCh38)
Location 10:85400495-85400517
Sequence CAGAATAAACAGAAGGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071411412_1071411420 22 Left 1071411412 10:85400450-85400472 CCAACACACAAAGCTGGTGGAGT No data
Right 1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071411420 Original CRISPR CAGAATAAACAGAAGGACCA TGG Intergenic
No off target data available for this crispr