ID: 1071413719

View in Genome Browser
Species Human (GRCh38)
Location 10:85421686-85421708
Sequence TCCCCTCAATAAGCCCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071413714_1071413719 15 Left 1071413714 10:85421648-85421670 CCACAGGCCTCCGGTACTTTCCC No data
Right 1071413719 10:85421686-85421708 TCCCCTCAATAAGCCCAAGCAGG No data
1071413710_1071413719 28 Left 1071413710 10:85421635-85421657 CCCTAACTCGCCTCCACAGGCCT No data
Right 1071413719 10:85421686-85421708 TCCCCTCAATAAGCCCAAGCAGG No data
1071413716_1071413719 5 Left 1071413716 10:85421658-85421680 CCGGTACTTTCCCAAGTAATTGA No data
Right 1071413719 10:85421686-85421708 TCCCCTCAATAAGCCCAAGCAGG No data
1071413717_1071413719 -5 Left 1071413717 10:85421668-85421690 CCCAAGTAATTGAAAGTTTCCCC No data
Right 1071413719 10:85421686-85421708 TCCCCTCAATAAGCCCAAGCAGG No data
1071413711_1071413719 27 Left 1071413711 10:85421636-85421658 CCTAACTCGCCTCCACAGGCCTC No data
Right 1071413719 10:85421686-85421708 TCCCCTCAATAAGCCCAAGCAGG No data
1071413713_1071413719 18 Left 1071413713 10:85421645-85421667 CCTCCACAGGCCTCCGGTACTTT No data
Right 1071413719 10:85421686-85421708 TCCCCTCAATAAGCCCAAGCAGG No data
1071413718_1071413719 -6 Left 1071413718 10:85421669-85421691 CCAAGTAATTGAAAGTTTCCCCT No data
Right 1071413719 10:85421686-85421708 TCCCCTCAATAAGCCCAAGCAGG No data
1071413715_1071413719 8 Left 1071413715 10:85421655-85421677 CCTCCGGTACTTTCCCAAGTAAT No data
Right 1071413719 10:85421686-85421708 TCCCCTCAATAAGCCCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071413719 Original CRISPR TCCCCTCAATAAGCCCAAGC AGG Intergenic