ID: 1071422526

View in Genome Browser
Species Human (GRCh38)
Location 10:85514902-85514924
Sequence TAAATTTATTAGAATTGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071422526_1071422529 15 Left 1071422526 10:85514902-85514924 CCCCGTCAATTCTAATAAATTTA No data
Right 1071422529 10:85514940-85514962 ACTACTACATGCCAACCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071422526 Original CRISPR TAAATTTATTAGAATTGACG GGG (reversed) Intergenic
No off target data available for this crispr