ID: 1071422529

View in Genome Browser
Species Human (GRCh38)
Location 10:85514940-85514962
Sequence ACTACTACATGCCAACCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071422526_1071422529 15 Left 1071422526 10:85514902-85514924 CCCCGTCAATTCTAATAAATTTA No data
Right 1071422529 10:85514940-85514962 ACTACTACATGCCAACCACTAGG No data
1071422528_1071422529 13 Left 1071422528 10:85514904-85514926 CCGTCAATTCTAATAAATTTACA No data
Right 1071422529 10:85514940-85514962 ACTACTACATGCCAACCACTAGG No data
1071422527_1071422529 14 Left 1071422527 10:85514903-85514925 CCCGTCAATTCTAATAAATTTAC No data
Right 1071422529 10:85514940-85514962 ACTACTACATGCCAACCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071422529 Original CRISPR ACTACTACATGCCAACCACT AGG Intergenic
No off target data available for this crispr