ID: 1071426199

View in Genome Browser
Species Human (GRCh38)
Location 10:85555880-85555902
Sequence ATGCAGTGACCACCATGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071426199_1071426200 -3 Left 1071426199 10:85555880-85555902 CCTTGGCATGGTGGTCACTGCAT No data
Right 1071426200 10:85555900-85555922 CATCAACTCTGACTTCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071426199 Original CRISPR ATGCAGTGACCACCATGCCA AGG (reversed) Intergenic
No off target data available for this crispr