ID: 1071431239

View in Genome Browser
Species Human (GRCh38)
Location 10:85608720-85608742
Sequence TGGAGCATACCCAGCAAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071431234_1071431239 -8 Left 1071431234 10:85608705-85608727 CCATTACTGGCAATGTGGAGCAT 0: 1
1: 0
2: 1
3: 10
4: 96
Right 1071431239 10:85608720-85608742 TGGAGCATACCCAGCAAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071431239 Original CRISPR TGGAGCATACCCAGCAAGGG GGG Intronic
No off target data available for this crispr