ID: 1071431891

View in Genome Browser
Species Human (GRCh38)
Location 10:85612972-85612994
Sequence CTGCTCTCCCAGCGCATCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071431891_1071431894 -6 Left 1071431891 10:85612972-85612994 CCCCTGATGCGCTGGGAGAGCAG 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1071431894 10:85612989-85613011 GAGCAGCGCCCTGTGTCCCTTGG No data
1071431891_1071431900 20 Left 1071431891 10:85612972-85612994 CCCCTGATGCGCTGGGAGAGCAG 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1071431900 10:85613015-85613037 GAAGTAAAAGAGAATCAGGAAGG No data
1071431891_1071431902 26 Left 1071431891 10:85612972-85612994 CCCCTGATGCGCTGGGAGAGCAG 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1071431902 10:85613021-85613043 AAAGAGAATCAGGAAGGAATGGG No data
1071431891_1071431899 16 Left 1071431891 10:85612972-85612994 CCCCTGATGCGCTGGGAGAGCAG 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1071431899 10:85613011-85613033 GTGAGAAGTAAAAGAGAATCAGG No data
1071431891_1071431901 25 Left 1071431891 10:85612972-85612994 CCCCTGATGCGCTGGGAGAGCAG 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1071431901 10:85613020-85613042 AAAAGAGAATCAGGAAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071431891 Original CRISPR CTGCTCTCCCAGCGCATCAG GGG (reversed) Intronic
900507287 1:3036054-3036076 CAACTCTCACAGCTCATCAGTGG - Intergenic
900946384 1:5833533-5833555 CTGATCTCCCAGGGCATTTGGGG - Intergenic
901311699 1:8274516-8274538 CTGCCTTCCCAGCGCCTCACAGG + Intergenic
901582043 1:10252532-10252554 CTGCACTCCCAGCTACTCAGGGG - Intronic
902553358 1:17232360-17232382 CTGTGCTCCCAGCTCCTCAGGGG - Intronic
903406872 1:23104619-23104641 CTGCTCTCAGAGCCCAGCAGAGG - Intronic
903636380 1:24820382-24820404 CTGTACTCCCAGTGCCTCAGGGG - Intronic
903795040 1:25922566-25922588 CTGCTCTCCCACCCCACCTGCGG + Intergenic
904307819 1:29601597-29601619 CTGCTCTCCCACCACACCACTGG + Intergenic
907679933 1:56553551-56553573 CTGCTCTCCAAGAGCATCTGGGG + Intronic
907759554 1:57343847-57343869 CGGCTCCCACAGTGCATCAGCGG + Intronic
909176665 1:72370533-72370555 CTGCTCTCCCAGTGCTTCCCAGG + Intergenic
914428280 1:147599169-147599191 CTGCACCCCCGGCGCATCAGCGG + Intronic
915594271 1:156887480-156887502 CTCCTCTCCCAGCCCAGCAGAGG - Intergenic
916078440 1:161217183-161217205 CTGCTCTCACCCCGTATCAGAGG - Intronic
917969379 1:180197245-180197267 CTGCCCTCCCTGCACAGCAGGGG - Exonic
918954862 1:191193760-191193782 CTTCCCTCCCTGCGCTTCAGAGG + Intergenic
920340258 1:205271281-205271303 CAGCTCTACCAGCACATCTGGGG - Intronic
921301318 1:213753963-213753985 CCGCCCTCCCAGGGCTTCAGGGG - Intergenic
922746697 1:228048240-228048262 CTGCTCTCCCAGGGCCTCGAGGG + Intronic
1066468401 10:35673030-35673052 CTGGTCTCCAAGCCCCTCAGGGG + Intergenic
1067159778 10:43815781-43815803 TTGCTCTCCCAAAGCATCAGAGG - Intergenic
1068228950 10:54144601-54144623 CTGATCTCCCATCGCCTCAGCGG + Intronic
1070984261 10:80674411-80674433 CTTCCCTCCCAGGGCCTCAGAGG + Intergenic
1071431891 10:85612972-85612994 CTGCTCTCCCAGCGCATCAGGGG - Intronic
1071496388 10:86170216-86170238 CAGCCCTCCCAGAGCATCTGGGG + Intronic
1071532400 10:86400381-86400403 CTGCAATCCCAGCGCATCCCGGG + Intergenic
1072539288 10:96385972-96385994 CTGCCCTCCCAGCCCCTCACTGG + Intronic
1073206734 10:101773402-101773424 CTGCTCTGCCAGCCCAGTAGGGG + Intronic
1074545772 10:114401321-114401343 CTGCTCTCCCAGCTGGTGAGTGG - Intronic
1075587879 10:123670588-123670610 CGGCTCTCCCAGCACATATGAGG - Intronic
1077313447 11:1904113-1904135 CTGCTCTCTCAGAGCAGCTGGGG - Intergenic
1080814703 11:35743731-35743753 ATGATTTCCCAGCTCATCAGTGG + Intronic
1081772875 11:45660552-45660574 CTCCTCTCCCAGGGCAGGAGAGG + Intronic
1083284504 11:61649562-61649584 CTGCAATCCCAGCTAATCAGGGG - Intergenic
1085300613 11:75456205-75456227 CTGATCTCCCAACCCATCATGGG - Intronic
1087695559 11:101371904-101371926 CTGCTCTATCAACACATCAGGGG - Intergenic
1096572283 12:52530501-52530523 TTGGTCTCCCAGCACCTCAGTGG + Intergenic
1103480723 12:121248350-121248372 CTGCTTTCAGAGCTCATCAGGGG - Intronic
1103560679 12:121791978-121792000 CAGCTCTCCCAGCTCACCAGGGG + Intronic
1103751593 12:123167777-123167799 TTGCTCCCCCAGCTCATCTGAGG + Intronic
1106931051 13:34665836-34665858 TTGCTCTGCCAGTGGATCAGTGG - Intergenic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1108251516 13:48572631-48572653 CTGTACTCCCAGCACTTCAGGGG + Intergenic
1114188076 14:20418674-20418696 CTCCCCTCCCAGCTTATCAGAGG - Intergenic
1116938604 14:50768573-50768595 CAGCTCTCCCCGTGCCTCAGAGG - Intronic
1122725218 14:103746219-103746241 CAGCTCTCCAAGCGCCTCACGGG + Intronic
1123862582 15:24484228-24484250 CTGCAGTCCCAGCTCCTCAGCGG - Intergenic
1124040304 15:26095890-26095912 TTGCTCTCTCAGGGCAGCAGGGG - Intergenic
1127302060 15:57664384-57664406 CTCCTCTCCTAGGGAATCAGAGG + Intronic
1129326283 15:74801868-74801890 CTTCTCTCTCAGGGCCTCAGGGG - Exonic
1129516820 15:76162125-76162147 CTGCTCTCCCCGCTCAGCTGTGG - Intronic
1129618131 15:77116321-77116343 CTGCTCTCCCTCCTCAGCAGAGG + Intronic
1130330330 15:82917443-82917465 CTCCTCTCCCAGGGCCCCAGGGG + Intronic
1132549414 16:548186-548208 ATGCTCTCCCTGCGCCTCAGGGG - Exonic
1135158181 16:20072161-20072183 CTGCTCTCCTAGGGCAGCCGTGG + Intronic
1136297062 16:29309658-29309680 GTGCTCTTCTAGCGCCTCAGCGG + Intergenic
1136774937 16:32866915-32866937 CAGATCTCCCACCCCATCAGAGG - Intergenic
1136895681 16:33994597-33994619 CAGATCTCCCACCCCATCAGAGG + Intergenic
1140248187 16:73270386-73270408 CTGTTCTCCACGCACATCAGTGG - Intergenic
1140411787 16:74745436-74745458 CTGCCCTCCCCACGCATCGGTGG - Intronic
1141148135 16:81546260-81546282 CTGCTCTCCCAGGACACCATGGG - Intronic
1142058612 16:88015762-88015784 GTGCTCTTCTAGCGCCTCAGCGG + Intronic
1203077355 16_KI270728v1_random:1129024-1129046 CAGATCTCCCACCCCATCAGAGG - Intergenic
1143270156 17:5669375-5669397 CTGCTGTCCCAGTTCCTCAGAGG + Intergenic
1143860956 17:9890312-9890334 CTGCTCTCCCAGGTCAGCTGGGG + Exonic
1144737467 17:17563179-17563201 CTTCTCTCCGAGGGCCTCAGGGG - Intronic
1149681958 17:58513556-58513578 CTGCTCTGCCTGCTAATCAGAGG + Intronic
1149965334 17:61157116-61157138 TTGCTTTCCCAGTGCATCTGGGG + Intronic
1150649696 17:67001718-67001740 CTGCTCTTCCAGGACTTCAGGGG + Intronic
1152831261 17:82498125-82498147 CTGCACTCCCAGCGCGTAGGAGG - Intergenic
1153145052 18:2021800-2021822 CTGCTGTCCCAGTACAACAGAGG - Intergenic
1153469075 18:5422820-5422842 CTGTTCTCCCAGTCCATCTGGGG + Intronic
1153723851 18:7936137-7936159 CTGCCCTGCCAGCTCAGCAGTGG - Intronic
1158314021 18:56190639-56190661 CTTGACTCCCAGCTCATCAGAGG - Intergenic
1162057669 19:8074381-8074403 CTGCTCTCCCACTGCCTCACAGG - Intronic
1165444618 19:35850036-35850058 CTGTACTCCCAGCTCCTCAGGGG - Intronic
1165445162 19:35852698-35852720 GTGGTCTCCCAGCTCAGCAGGGG + Intronic
1166605156 19:44135488-44135510 CTGCCCTCCCACCCCATCAAAGG - Intergenic
1168163904 19:54533595-54533617 CAGGTATCCCAGGGCATCAGGGG + Intronic
925154474 2:1639118-1639140 CTGCCCACTCAGAGCATCAGGGG - Intronic
925914318 2:8593956-8593978 GTGCTCTCCCAGCCCATCCCTGG + Intergenic
927154665 2:20214525-20214547 CAGATCTGCCAGCCCATCAGAGG - Intronic
927869629 2:26615394-26615416 CCGCTCTCCCAGGGCATCCTGGG - Intronic
927971098 2:27306749-27306771 CTGCCCTCCCAGCACCCCAGAGG - Intronic
928023792 2:27723565-27723587 AAGCTCTCCCAGCGCCACAGTGG - Intergenic
928226683 2:29455356-29455378 CTGCTCTCCCAGGGTAGGAGAGG - Intronic
931122421 2:59234617-59234639 GTCCTCTCCCAGCACATCATGGG - Intergenic
935182644 2:100704431-100704453 CTCCTCCCCCAGCGCACCATGGG - Intergenic
935849325 2:107201293-107201315 CTGTTCTCCCACAGCATCTGTGG + Intergenic
937317535 2:120941507-120941529 CTGCTCTCCCAGGGCCTCCCTGG - Intronic
940665947 2:156609873-156609895 CTCCTCTCCAAGAGTATCAGAGG + Intronic
943023975 2:182606958-182606980 CTGGTCTCCCATCTCCTCAGCGG - Intergenic
948397867 2:237661068-237661090 CTGCTCTCCCACCGCTTCCTGGG + Intronic
1169231154 20:3889584-3889606 CTGCTCGCCCGGCGCCGCAGTGG - Exonic
1173642822 20:44615620-44615642 CTGCTCTCACAGCGCCACAGAGG + Intronic
1174738391 20:52987112-52987134 CTCCTCTCCCAGGATATCAGCGG + Intronic
1175230245 20:57469337-57469359 CTCCTCTCCCAGAGCCTAAGGGG - Intergenic
1178709492 21:34902317-34902339 CTGCTCTACCAGCTCACCAAGGG - Intronic
1179995871 21:44973738-44973760 CTGCCCTCCCAGGGGTTCAGCGG + Intronic
1181037727 22:20178038-20178060 GTGCCCTCCCAGCCCTTCAGGGG + Intergenic
1181325682 22:22043908-22043930 GTGCTCACACAGCGCCTCAGGGG + Intergenic
1184115086 22:42417590-42417612 CTGCCCTCCCTGAGCCTCAGGGG - Intronic
1184446511 22:44550667-44550689 CTACTCTCCTAGCTGATCAGTGG + Intergenic
953223750 3:40998242-40998264 CTGCCCTCCCCGCCCACCAGGGG + Intergenic
954302478 3:49707196-49707218 CTTCTCTCCCAGTGCATCAGGGG + Intronic
962384677 3:134923274-134923296 CTGCTACCCCAGCGAAACAGGGG - Intronic
966865595 3:184257589-184257611 ATGGTCTCCCAGCGCAGCTGCGG - Exonic
968889433 4:3359743-3359765 CTGTTCTCCCAGCTACTCAGGGG - Intronic
969130625 4:4988754-4988776 CTTTTCTCCCAGCTCATCTGTGG + Intergenic
969513902 4:7635841-7635863 CTGCTCTGCCAGCACACCAAGGG - Intronic
969571020 4:8008445-8008467 CTGGCCTCCCAGAGCCTCAGTGG - Intronic
971196769 4:24477557-24477579 CTGATCTTCCAGCTCCTCAGTGG + Intergenic
972031987 4:34472736-34472758 CTGCGATCCCAGCTCCTCAGGGG + Intergenic
972802086 4:42487292-42487314 CTGCTTTCCCAGCTCTTCAAAGG + Intronic
975841361 4:78477740-78477762 CTGCTTCCCCAGGGCATCATAGG - Intronic
976729668 4:88249100-88249122 CTGCTGTCCCAGCCACTCAGAGG - Intergenic
977643323 4:99382732-99382754 ATTCTCTCCCAGGGCATCTGGGG + Intergenic
982026652 4:151258631-151258653 CTGCTCTCCCAGGACAGCAGGGG + Intronic
982028585 4:151276933-151276955 CTGCTCTCCCAGGACAGCAGGGG + Intronic
986153093 5:5145836-5145858 CTGCCCTCCCAGCCACTCAGGGG - Intronic
988555894 5:32235787-32235809 CTACTCTCCCTGCTCATCAAGGG - Intronic
989120939 5:38004001-38004023 CTTCTCCCCTAGCCCATCAGAGG + Intergenic
989272996 5:39554423-39554445 CTGCTCTCACAGAACACCAGAGG + Intergenic
990609099 5:57440143-57440165 CTGGGCTCCCAGCCCATCAGGGG - Intergenic
994215934 5:97137225-97137247 CTGCTCTCCCATCTCACCAGAGG - Intronic
997255893 5:132427718-132427740 TTGCTCTACCAGCTCAGCAGAGG - Intronic
997611126 5:135216472-135216494 CTGCTTTCCCAGAGCATGGGGGG - Intronic
998040079 5:138946160-138946182 CAGCTTTCCCAGTGCACCAGAGG - Intergenic
998621721 5:143801526-143801548 CTGCTTTCCCATCCCAACAGTGG - Intergenic
1001003542 5:168029965-168029987 ATGCTTTCCCATCACATCAGAGG - Intronic
1001238940 5:170053360-170053382 CTGCTCTCCCACTACAACAGCGG - Intronic
1002182798 5:177440263-177440285 CTTCTCTCCCAGCCAATCAGAGG - Intronic
1003038136 6:2662575-2662597 CTCCTCTCTCAGCCCAGCAGTGG - Intergenic
1004187868 6:13436987-13437009 CTGCTTTCCCAGAGCCTCTGAGG - Intronic
1004771145 6:18783763-18783785 CTTCTCTCCCTGCACAGCAGAGG - Intergenic
1007622577 6:43224004-43224026 TGGCCCTCCCAGAGCATCAGTGG + Intronic
1016568217 6:145482626-145482648 CTTCTCTCCAAGCGCATGTGAGG - Intergenic
1017950009 6:159128448-159128470 ATGCTCTCCCAGGCCTTCAGAGG - Intergenic
1019415707 7:925702-925724 CTGGCCTCCCAGCCCATGAGGGG - Intronic
1021783596 7:24130536-24130558 GTGCTCTTCCAGGTCATCAGTGG - Intergenic
1022547317 7:31201183-31201205 CTGCTTTCCCCACACATCAGGGG + Intergenic
1024475514 7:49804373-49804395 CAGCTCTCCCAGCAGACCAGAGG - Intronic
1024951280 7:54863154-54863176 CTCCTCTGCCAGAGCATGAGGGG + Intergenic
1024960575 7:54970663-54970685 CTCCTTCCCCAGCGCACCAGCGG - Intergenic
1028963612 7:96777016-96777038 CAGCTCTCCTAGTGCCTCAGTGG + Intergenic
1029105275 7:98169938-98169960 CTGCTCTGCCAGGGGAGCAGTGG - Intronic
1033325098 7:140371114-140371136 CAGCTCTCACAGCACCTCAGTGG + Intronic
1036615428 8:10383942-10383964 CTGCTTTCCCAGGGGCTCAGAGG + Intronic
1038281025 8:26164812-26164834 CTGCAGTCCCAGCTAATCAGGGG + Intergenic
1041755740 8:61311472-61311494 CTGCTCTCCCATCCAATCTGTGG - Intronic
1045320673 8:101079776-101079798 CTGCTCTTCCAGCTGACCAGGGG - Intergenic
1045493544 8:102688991-102689013 CTGCTCTGCCAGGGCGTCTGAGG - Intergenic
1047965009 8:130040031-130040053 CAGCATTCCCAGGGCATCAGAGG + Intergenic
1048460777 8:134619946-134619968 CTGCTCCTGCAGAGCATCAGAGG - Intronic
1049202487 8:141347140-141347162 CGGCATTCCCAGCGGATCAGTGG + Intergenic
1049275630 8:141718781-141718803 CTGCTCTGCCAGAGCATCTTGGG - Intergenic
1049720382 8:144112827-144112849 CTGCCCTCCCAGCGCCTCCACGG - Intronic
1054905952 9:70413736-70413758 TTCCTCTCCCAGCGCCTCGGGGG - Exonic
1055954237 9:81759239-81759261 CTGCTGTCCCAGGGAAGCAGAGG - Intergenic
1057574649 9:96232581-96232603 CTTCTCTCCCAGAACATTAGAGG + Intergenic
1060266133 9:122112387-122112409 CTGCCCTCCCAGGGCAGCTGTGG - Intergenic
1061611001 9:131745742-131745764 CTGGTCTCCAAGAGCTTCAGGGG + Intergenic
1061680987 9:132242271-132242293 CTGCCCTCCCCCCGCAGCAGGGG + Exonic
1062422326 9:136488781-136488803 CTGCTCTGCCAGCGCCCCACAGG - Intergenic
1062644567 9:137540826-137540848 CTGCTCTCATGGCGCCTCAGAGG - Intronic
1188099976 X:26071512-26071534 CTGCTCACCCAGCACCTCAGAGG - Intergenic
1192369414 X:70500782-70500804 CTGCCCTCTCAGAGCAGCAGTGG - Intronic
1197093798 X:122571146-122571168 CTGGTGTCCCAGTGCCTCAGTGG - Intergenic
1200408834 Y:2841901-2841923 GTGCTCTCCAAGCGAATCTGAGG - Intronic