ID: 1071433542

View in Genome Browser
Species Human (GRCh38)
Location 10:85625607-85625629
Sequence AAGGTGTTTGCTGGGGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 314}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071433542_1071433551 16 Left 1071433542 10:85625607-85625629 CCTTGTCCCCCAGCAAACACCTT 0: 1
1: 0
2: 0
3: 30
4: 314
Right 1071433551 10:85625646-85625668 TCTCAGTCTACCTGCTCCCTGGG No data
1071433542_1071433553 29 Left 1071433542 10:85625607-85625629 CCTTGTCCCCCAGCAAACACCTT 0: 1
1: 0
2: 0
3: 30
4: 314
Right 1071433553 10:85625659-85625681 GCTCCCTGGGTTGTTGCAAAAGG No data
1071433542_1071433550 15 Left 1071433542 10:85625607-85625629 CCTTGTCCCCCAGCAAACACCTT 0: 1
1: 0
2: 0
3: 30
4: 314
Right 1071433550 10:85625645-85625667 TTCTCAGTCTACCTGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071433542 Original CRISPR AAGGTGTTTGCTGGGGGACA AGG (reversed) Intronic
900503938 1:3019833-3019855 GAGGCCTGTGCTGGGGGACACGG - Intergenic
901173155 1:7279005-7279027 AAGGCATTTGGTGGGGGAAAGGG + Intronic
901780334 1:11590104-11590126 GAGGTGAGTGCTGAGGGACATGG - Intergenic
902171375 1:14614260-14614282 AGGGTGTTTGCAGAGGAACAGGG - Intronic
902464333 1:16606536-16606558 AAATTGTGTGCTGGAGGACAGGG + Intronic
902807893 1:18872275-18872297 AAGGTGTGTGGCTGGGGACAGGG + Exonic
902885722 1:19403338-19403360 AAGGGGCATGCTGGGGGGCAGGG + Intronic
905581303 1:39084324-39084346 AAGGTGTCCCCTGGGGGACAGGG - Exonic
907664354 1:56421317-56421339 AAGTTGTTTCCTGTGGGATATGG - Intergenic
908341878 1:63189759-63189781 TAGGAGATTGCTGGGGGAGAAGG - Intergenic
909233512 1:73121319-73121341 AAGGTGCTTGCTGAGGGCAAAGG + Intergenic
911315104 1:96346807-96346829 ATGGTGCTTGGTTGGGGACAGGG + Intergenic
911796714 1:102085985-102086007 TAGGTGTGTGATGGGGGAGATGG + Intergenic
911921453 1:103766723-103766745 TATGTGTGTGCTGGAGGACAGGG - Intergenic
912373425 1:109191273-109191295 AGAGCGTCTGCTGGGGGACAGGG - Intronic
913107090 1:115624681-115624703 AAGGAGTTGGTTGGGGTACAGGG + Intergenic
913601161 1:120422150-120422172 AAACTGTGTGCTGGAGGACAGGG - Intergenic
913993073 1:143633520-143633542 AAATTGTGTGCTGGAGGACAGGG + Intergenic
914085883 1:144454451-144454473 AAACTGTGTGCTGGAGGACAGGG + Intronic
914093570 1:144525549-144525571 AAGGGGTTTGCTTTGGGAAAGGG + Intergenic
914191780 1:145418431-145418453 AAACTGTGTGCTGGAGGACAGGG + Intergenic
914231946 1:145770345-145770367 AAGGTGTGTGTTGGGGGAAAGGG + Intronic
914349141 1:146824756-146824778 AAGGTGTTTTCATGGGGAGAAGG - Intergenic
914362349 1:146945706-146945728 AAATTGTGTGCTGGAGGACAGGG - Intronic
914489325 1:148141377-148141399 AAATTGTGTGCTGGAGGACAGGG + Intronic
914589705 1:149096432-149096454 AAACTGTGTGCTGGAGGACAGGG + Intronic
914928408 1:151908478-151908500 AAGGTGGTTGGTGGAGGGCAGGG - Intronic
914939296 1:152007841-152007863 AAATTGTGTGCTAGGGGACAAGG - Intergenic
915663503 1:157423758-157423780 AATGTGATTGCTGGGTGAAATGG - Intergenic
916496694 1:165354152-165354174 AGTGTTGTTGCTGGGGGACAAGG - Intronic
916756622 1:167776873-167776895 AAGGTGTTAGCTGGTGGGAATGG + Intronic
917453532 1:175166791-175166813 AAGTTCTGTGTTGGGGGACATGG + Intronic
917598921 1:176556466-176556488 ACGTTGTTGGCTGGGGGCCAAGG + Exonic
918048594 1:180955710-180955732 ACGGGGTTTGTGGGGGGACAGGG - Intergenic
918795242 1:188886837-188886859 AGGATGTTTCCTGGGGGACATGG - Intergenic
919124107 1:193376019-193376041 GAGGTGTTTGCTGGAGGCAAGGG - Intergenic
919134801 1:193494237-193494259 AAGGTGTTTGCTAGTGGGGAAGG + Intergenic
919768870 1:201144481-201144503 AAGGTGTGTGCTGGGGGTGAAGG + Intronic
920958535 1:210642813-210642835 ATGATGTTTTCTGAGGGACAAGG + Intronic
921221560 1:212977534-212977556 AAGGTGGTGGGTGGGGGAGAGGG + Intronic
921605753 1:217152456-217152478 AATGTGTTTATTGGGGGAGAAGG + Intergenic
923378328 1:233389429-233389451 AAGTTGTATGCAGGGAGACAGGG - Intergenic
1062865706 10:851472-851494 AAGGTGTTTTCTGTTGGGCATGG - Intronic
1063080388 10:2762164-2762186 AAGGTGGTTGCTGGGGGCTGGGG - Intergenic
1065918595 10:30371928-30371950 AAAGAGCTTGCTGGGAGACAGGG - Intronic
1067272926 10:44807940-44807962 AGGGTGTGCTCTGGGGGACAGGG - Intergenic
1068159006 10:53239611-53239633 GAGGTGTTTTATGGGAGACAGGG - Intergenic
1068632353 10:59311040-59311062 AATGTGTTCCCTGGGGGACCAGG - Intronic
1068643895 10:59444092-59444114 AATGGGATTGCTGGGTGACACGG - Intergenic
1069098584 10:64290053-64290075 AAGGTGTATGCTTGGGCACGTGG + Intergenic
1070380176 10:75874074-75874096 AAGAGGTTTGCTGGGGGTGAGGG - Intronic
1070524540 10:77283970-77283992 AAGGCGTGTGCTGTGGGAAAGGG + Intronic
1070832562 10:79428340-79428362 ATGGTGGTTGCTGGGGGGCAGGG + Intronic
1071433542 10:85625607-85625629 AAGGTGTTTGCTGGGGGACAAGG - Intronic
1071525446 10:86355503-86355525 GGGGTGTTAGCTGGGGGACTAGG - Intronic
1071573234 10:86709365-86709387 GAGGTGTGTGTTGGGGGAGAGGG + Intronic
1072491714 10:95913095-95913117 AAGGTATTGGGTGGGGGGCAGGG - Intronic
1072743313 10:97923244-97923266 AAGGTGAGTGCAGGGGCACATGG - Exonic
1072793812 10:98338854-98338876 TCCGTGTTTGCTGGGGGACAAGG - Intergenic
1073118387 10:101106432-101106454 AAAATGTCAGCTGGGGGACAGGG + Intronic
1076601569 10:131660173-131660195 AAAGAGTTTGGTGGGGGAGATGG + Intergenic
1079017677 11:16883308-16883330 AGGGTGTTTCCTGGTGAACAAGG - Intronic
1080048166 11:27831237-27831259 AAAAGGTTTGCTGGGGGAAATGG + Intergenic
1080990907 11:37533528-37533550 AAGGTGTTTGTTATGGGAAAGGG + Intergenic
1081022490 11:37964526-37964548 AGAGTGATTGCTGGGTGACATGG - Intergenic
1081099350 11:38982788-38982810 CACCTGTTTGCTGGGGGGCAGGG - Intergenic
1081785501 11:45744078-45744100 AAGGTGTGTGCAGGGGGAGATGG - Intergenic
1082007212 11:47426116-47426138 AAGGAGGTGGCTGGGGGTCAAGG - Intronic
1083112218 11:60422564-60422586 AAGGTGTTTGCTGAAGGCAAAGG - Intergenic
1084190234 11:67495338-67495360 AGGCTGTGTGCTGGGGGAAAGGG + Intronic
1084597113 11:70123505-70123527 AAGGTCATGGCTGGGGGACGAGG - Intronic
1084668756 11:70592807-70592829 AAGGTGCATGCAGAGGGACATGG - Intronic
1084714133 11:70862999-70863021 AAGGTGTGAGCTGGTGGGCAGGG + Intronic
1087428837 11:98024919-98024941 AAGGTCTTTGTTGTGAGACAGGG - Intergenic
1087770520 11:102204656-102204678 AAGGAGTTTGCTGTGTGACTGGG + Intronic
1088999658 11:115041137-115041159 TAGGTGTTTGGTGGGGAACCGGG + Intergenic
1089343887 11:117777950-117777972 CAGGTGCCTGCTGAGGGACAAGG - Intronic
1089831559 11:121333270-121333292 AATGTGTTTGCTGGATTACATGG - Intergenic
1089890656 11:121877428-121877450 AAGATGTTTGCTTGTGTACAAGG - Intergenic
1091395701 12:153180-153202 TAGGTGCTTCCAGGGGGACACGG + Intronic
1092045316 12:5428386-5428408 AAGGTGTTTGCACAGGGACTGGG - Intergenic
1094092446 12:26665670-26665692 AAGGTGTTTGCTGGGGCTGCAGG - Intronic
1096405317 12:51339879-51339901 ATGGTGTGTGCTGGTGGAGATGG - Exonic
1096908276 12:54956629-54956651 AAGCTGTTGGCTGCGGGTCAAGG + Intronic
1097053730 12:56238300-56238322 CAGGTGTGTGTTGGGGGGCACGG - Exonic
1097262896 12:57729438-57729460 AAGGAATTAGCTGGGGAACAAGG + Intronic
1099458541 12:82894676-82894698 AAGTTTCTTGCTGGGGGAGAAGG + Intronic
1099935435 12:89119361-89119383 AATGTGTTTGTTGGGGGACGGGG - Intergenic
1101295320 12:103417480-103417502 AAGGTGTGTGCAGGGGAATATGG - Intronic
1101708523 12:107243303-107243325 CAGGAGTTTGCTTGAGGACAAGG + Intergenic
1101802002 12:108030613-108030635 GAGCTGTTAGCTGGTGGACATGG + Intergenic
1103322689 12:120101152-120101174 AAGGTGATTCCTGGTGGCCATGG - Intronic
1106037148 13:26053133-26053155 AAGGTGTGTGTTGGGGAGCAGGG - Intergenic
1108147388 13:47493081-47493103 AAGTTAATTGCTGGGGGCCAAGG - Intergenic
1110346188 13:74450412-74450434 TAGCTGATTGCTGGGGGCCATGG + Intergenic
1110798628 13:79669710-79669732 AAGGGGGTGGCTGGGGGATATGG - Intergenic
1111971269 13:94919246-94919268 AAGGTGGTTGCCGGGGGAGAGGG + Intergenic
1112019852 13:95362238-95362260 AAGGGGTTTGCTTTGGGAAAGGG - Intergenic
1112711565 13:102135321-102135343 CAGATGTTAGCTGGGGCACATGG - Intronic
1112796659 13:103064533-103064555 AAGCTGTTTATTGGGGGTCAAGG + Intronic
1113060191 13:106314316-106314338 AAGGTGGTGGCTGGGGGAGGAGG + Intergenic
1114597521 14:23926102-23926124 CAAGTGTTTGATGGGGGTCAGGG + Intergenic
1116296969 14:43123639-43123661 ATGGTGGTTGCTGGGGGTAAGGG + Intergenic
1116871221 14:50070681-50070703 AAGGTTTTTTCTTGGGGAAAAGG - Intergenic
1117215270 14:53545318-53545340 AAGGTGGTAGCTGGGGGAAGTGG - Intergenic
1117766321 14:59087166-59087188 AAGGTTTTTCCTGGGGGCAAGGG - Intergenic
1119368960 14:74121235-74121257 AAGTTGTTTGGGTGGGGACAGGG - Intronic
1119879601 14:78090103-78090125 AAGGTGTTGGTGAGGGGACAGGG + Intergenic
1120210228 14:81626902-81626924 AAGTCTTTTGCTTGGGGACAGGG + Intergenic
1121037165 14:90715928-90715950 AAGGTCTGTACTGGGGGAGAAGG - Intronic
1125747648 15:42008123-42008145 CAGGTGTTTGCTCAGGGACAAGG - Intronic
1127382866 15:58444810-58444832 AAAGTGTTTGCTGGGTGTAATGG - Intronic
1128112585 15:65085925-65085947 CACCTGTTTGCTGGGTGACATGG + Intergenic
1128155358 15:65388577-65388599 AAGATGTTTCCTGGGGGTGAGGG + Exonic
1128296553 15:66525673-66525695 ATGGAGTTTGGTGGGGGCCAGGG - Intronic
1128566330 15:68702628-68702650 AAGGTGTTTGCTTAGGGGCCAGG - Intronic
1128756352 15:70186321-70186343 AAGGTGTTGCCTGGGGAACCAGG + Intergenic
1128914284 15:71545820-71545842 GAGTTTTTTGGTGGGGGACAGGG - Intronic
1129908620 15:79207755-79207777 CAGGTGTTTTCAGGAGGACATGG - Intergenic
1130520246 15:84656447-84656469 CAGATGTCTGCTGGGGGAGAGGG - Intronic
1131772415 15:95753330-95753352 GAGGTGATTGTTGGGGGATATGG - Intergenic
1132391075 15:101438670-101438692 CAGGTGGTTCCTGGGGGACCTGG - Intronic
1132408819 15:101561515-101561537 CAGGTGTAAGCTGGGGGACAAGG + Intergenic
1132655881 16:1041482-1041504 AAGGTGTGAGCTGGGGGTCTTGG - Intergenic
1132666906 16:1085157-1085179 CATGTGTTTCCTGAGGGACACGG + Intergenic
1132828588 16:1916937-1916959 CAGGTGGTGGCTAGGGGACATGG - Intronic
1134351582 16:13442590-13442612 AATTTGTTTGCTGGGTGAGATGG - Intergenic
1134692782 16:16201981-16202003 AAGGTGAGCCCTGGGGGACAAGG - Exonic
1134979066 16:18592714-18592736 AAGGTGAGCCCTGGGGGACAAGG + Intergenic
1135326316 16:21527987-21528009 GAGGAGTTTGCTGAAGGACAGGG - Intergenic
1138134006 16:54505855-54505877 AATGTGTTTGCTGTGCGACTCGG - Intergenic
1138350941 16:56345934-56345956 AGGGCGGCTGCTGGGGGACATGG - Exonic
1140033648 16:71357486-71357508 AAGGAGGTCGCTGGGGGAGAGGG - Intergenic
1141917332 16:87108348-87108370 AAGGTGTTTTCACGTGGACATGG - Intronic
1142014990 16:87740562-87740584 AAGGTGTGTCCTGGTGGAGATGG - Intronic
1143804262 17:9413381-9413403 AGGCTGGTAGCTGGGGGACATGG + Intronic
1144185313 17:12790436-12790458 AAGGCGTTTGGTGGGGGGAAAGG + Intronic
1145275450 17:21426575-21426597 AGGGTGTGTGCTGGGGAACGGGG + Intergenic
1145313303 17:21712469-21712491 AGGGTGTGTGCTGGGGAACGGGG + Intergenic
1145711751 17:26984424-26984446 AGGGTGTGTGCTGGGGAGCAGGG + Intergenic
1146547988 17:33755679-33755701 AAGGAGTTTGCAGGAGAACAGGG + Intronic
1146631912 17:34476205-34476227 AAGGAGTTTGCTGAGGGGCCGGG + Intergenic
1147601201 17:41746666-41746688 GAGGTGTTTGCTGGGCCCCAGGG - Intergenic
1148167365 17:45492686-45492708 TATGTGCTTGATGGGGGACAGGG - Intergenic
1148681451 17:49476289-49476311 AAGGGGTTGGTTAGGGGACAGGG - Intronic
1149507855 17:57210944-57210966 AAAGTGTTTACTGGAGGAGAGGG + Intergenic
1149589528 17:57818272-57818294 TAGGTGATTGCTGAGGGCCAGGG - Intergenic
1150999466 17:70358003-70358025 ATGGTGGTTGCTGGGGGAGTGGG - Intergenic
1152089430 17:78238623-78238645 CATGTGTGTGCTGGGGGCCATGG + Intronic
1152724043 17:81936648-81936670 AAGGTGGGTGCTGGGTCACAAGG - Intronic
1154009993 18:10565905-10565927 AAGGAGTTTGCTGGGTCACAAGG - Intergenic
1155502363 18:26499865-26499887 AAGTTTTTTGCTGGTGGATAGGG - Intronic
1155719744 18:28996221-28996243 AAGATGGATGCTGGTGGACATGG + Intergenic
1156291840 18:35754582-35754604 AAGGTGGTTCCTGAGGGGCATGG + Intergenic
1156469232 18:37367142-37367164 AAGGTGTTTGCAGGAGGAAGAGG + Intronic
1157207519 18:45713466-45713488 AAGGTGTGTGCTGTGAGTCATGG - Intergenic
1157491451 18:48126683-48126705 GAGGTGTGTGCTGGGAGAAAGGG + Intronic
1159617790 18:70601209-70601231 CAGGTGTCTGCTGGGACACAGGG - Intergenic
1159714444 18:71804312-71804334 AAGGGGTTTGATGGGGAAAAGGG + Intergenic
1160029447 18:75246009-75246031 GTGGTGTTTGCTGGGGGAGAGGG - Intronic
1162175863 19:8829696-8829718 AAGGGGTTTGCTAGGGCACAGGG - Intronic
1162199832 19:9011916-9011938 AGGGTGTTTCCTGGGGCTCAAGG - Intergenic
1163026960 19:14518119-14518141 AAGGTGTGTGCTCGCGGCCAGGG - Exonic
1163826520 19:19527574-19527596 TAGGAGTTGGCTGGGGGAAAAGG + Intronic
1163847317 19:19645148-19645170 ACGGTGTTTGCTGGGGGCTCGGG - Intergenic
1167299512 19:48670822-48670844 AAGGTGGTTTCCTGGGGACAGGG + Exonic
1167588398 19:50388367-50388389 AACTGGTTTCCTGGGGGACAGGG - Intronic
1168276672 19:55282694-55282716 AAGGTGTTGAATGGGGGACTGGG + Intronic
1168710657 19:58498232-58498254 AGGTTCTTTGCTGGGAGACAGGG + Intronic
925285272 2:2711729-2711751 TATGTGTGTGGTGGGGGACAGGG + Intergenic
925922783 2:8648345-8648367 GGGGCATTTGCTGGGGGACATGG + Intergenic
927712810 2:25336232-25336254 AGCGTGTGTGTTGGGGGACAGGG + Intronic
929214571 2:39398105-39398127 AGGGTGTTTGCTAGGTGAAAGGG - Intronic
930591658 2:53334650-53334672 AAGGTGTATTCTGGGAGAAAGGG - Intergenic
931635034 2:64333156-64333178 AACCTGGGTGCTGGGGGACAGGG - Intergenic
932114578 2:69034916-69034938 TAGGTGTTGGCTGGGGGAAATGG - Intronic
932466507 2:71927591-71927613 AGGGTGTTGGCTGGGGGAGCAGG - Intergenic
933267251 2:80194519-80194541 CAGGTGTGTGGTGGGGGATAGGG + Intronic
933360499 2:81276777-81276799 ATGGTGGTTGCTGGGGCAGAGGG + Intergenic
933536611 2:83583344-83583366 AAGGGGTTTGTTTGGGGAAAGGG + Intergenic
933863122 2:86489802-86489824 AAGGTGGTTGCTAAGGAACAAGG + Intronic
933895511 2:86807419-86807441 AAGCTGATTGTTGGGGCACAGGG - Intronic
934553545 2:95276182-95276204 AAGGTGCTTGCTGGGTAAGAGGG - Intronic
936047908 2:109201096-109201118 AAGGTCTGTGCTGAGGGACAGGG - Intronic
936443442 2:112576520-112576542 AGGGTGGTTGCTAGGGGCCAGGG - Exonic
937078779 2:119125760-119125782 GAGGTGTTTCCTGGGAGAAAGGG - Intergenic
940682380 2:156803390-156803412 CCGCTGTTTGCTGGGGGTCAGGG - Intergenic
947032728 2:225816562-225816584 AAGGTGTTAGTTTGGGGAAAGGG - Intergenic
947486032 2:230549867-230549889 AAGGTGGTTGCTGGTTGTCAGGG - Intergenic
948866296 2:240776428-240776450 AGGGAGTTTGATGGGGGAGAGGG - Intronic
1169729178 20:8767894-8767916 AAGGTGTTGGCTGGGCGCAATGG + Intronic
1170006330 20:11673445-11673467 GAGGTGCTTGCTGAGGGAAAAGG + Intergenic
1172173755 20:32960215-32960237 AGGGTGGCTGCTGGTGGACATGG - Intronic
1173040079 20:39453956-39453978 CAGGTCTTTGCTGAGAGACAGGG - Intergenic
1174007198 20:47420172-47420194 AAGATGTGTGCTGGGAGACCTGG + Intergenic
1174541912 20:51296457-51296479 CATCTGTTCGCTGGGGGACAGGG - Intergenic
1176066996 20:63203069-63203091 AGGGTGCCTGCTGGGGGACTGGG + Exonic
1176072430 20:63234202-63234224 GAGGTGGTCGCTGGAGGACAGGG + Intergenic
1176385527 21:6137133-6137155 AAGGTTGTTTCTGGGGGCCATGG - Intergenic
1177403341 21:20634624-20634646 AATGTGTGTGGTGGGGGTCATGG + Intergenic
1179414863 21:41190588-41190610 AAGGTGTTTGCTGAAGGCAAAGG - Intronic
1179737946 21:43401119-43401141 AAGGTTGTTTCTGGGGGCCATGG + Intergenic
1181637261 22:24180309-24180331 GAGGCGTGTGCTGGGGGACTTGG - Intergenic
1182883764 22:33755978-33756000 AAGGTGTTGGCTGGGAGGGAGGG + Intronic
1183263936 22:36814228-36814250 AAGGTGATACCTGGAGGACAGGG + Intronic
1183858714 22:40653598-40653620 TAGCTGTTTGATGGAGGACAGGG + Intergenic
1184111185 22:42396509-42396531 TATGTGTATGCTGGGGGAGAGGG + Intronic
1184263440 22:43332938-43332960 AAGGCATTTGCTGGATGACAGGG - Intronic
1184343871 22:43901104-43901126 AAGGTGATGGCAGGGTGACAAGG - Intergenic
1184600134 22:45538672-45538694 AGGGTGCGTGCTGGGGGACCAGG - Intronic
951127236 3:18998183-18998205 AAGGTGTCTGATGGATGACATGG + Intergenic
952964894 3:38614933-38614955 AAGGTGGTCTCTGGGGGGCAGGG + Intronic
953118147 3:40013130-40013152 AAGGTGTGAGGAGGGGGACATGG - Intronic
953662983 3:44904490-44904512 AAGGACCTTGCCGGGGGACAAGG + Intronic
953673069 3:44978737-44978759 AAGGGGTGGGCTGGGGGAAATGG + Intronic
953782505 3:45884141-45884163 AAGGTGAGTTCTGGAGGACAGGG - Intronic
953889918 3:46743980-46744002 CAGGTGTTTGAAGGTGGACAAGG + Exonic
954367967 3:50156107-50156129 AAGGTGGCAGCTGGGGGTCAAGG - Intronic
959186632 3:103054230-103054252 AATGTGTTTCCTCTGGGACAGGG + Intergenic
960119039 3:113927730-113927752 AAGGTGTTTCCTGGGGCAACAGG + Intronic
961049258 3:123733175-123733197 AAGGTGTGAGCTGGAGGAAAGGG + Intronic
962167887 3:133069279-133069301 CAGGTCTTTGCTGGGTCACATGG + Intronic
962348439 3:134639580-134639602 AAAGTGTTTGCATGGGGATAAGG + Intronic
962976238 3:140448564-140448586 CAGGTGGATGCTGGGGAACAGGG - Exonic
967049672 3:185771036-185771058 AAGCCGTTTGCTGGGTGCCATGG - Intronic
967182057 3:186913917-186913939 AAAGTGTTTGCAGGGAGAGAAGG - Intergenic
967833132 3:193939309-193939331 ATGGTCTTTGCTGGAGGCCATGG - Intergenic
967951970 3:194848102-194848124 GAAGAGTTTGCTGGGAGACAGGG - Intergenic
968867090 4:3220029-3220051 GAGCTGTTTTCTGGGGGAGAAGG + Intronic
969030265 4:4206404-4206426 AGGATGTCTGCTGTGGGACAGGG + Intronic
969098569 4:4752253-4752275 CAGGAGTTTGCTGGGGGACTTGG + Intergenic
969549123 4:7852650-7852672 AAGGGGTTTGCTGGGGGCACCGG + Intronic
969997721 4:11331562-11331584 ATGGTGTCTCCTGGGGTACAAGG + Intergenic
971460255 4:26888601-26888623 AAGGTGCTTGCTAAGGGAAAGGG - Intronic
975403046 4:73959443-73959465 AATGTGATTGCTGGGTTACATGG + Intergenic
976634573 4:87275030-87275052 AAGGGGTGTGCTGGTGGACAAGG + Intergenic
977179508 4:93856952-93856974 TAGGTGTTTGCTGTGGGAATGGG - Intergenic
977610544 4:99025634-99025656 CAGATGGTTGCTGGGGGCCAGGG - Intronic
981340196 4:143613242-143613264 AATGTGTTTGCTAGGGCAGAGGG + Intronic
981454691 4:144939661-144939683 TAGGTGTTTGCTGGGGCATGAGG - Intergenic
981706580 4:147665522-147665544 AAGGGATTTGGTGGGGGAAAGGG - Intronic
982464294 4:155710959-155710981 CTGGGGTTTGCTGGGGGACAGGG - Exonic
983093190 4:163530269-163530291 ATGGTGTTTGCTGGGGATCTGGG - Intronic
985025227 4:185733547-185733569 AAGGTGTGTGCTTGGGGATAAGG + Intronic
985028260 4:185761134-185761156 CAGGTGTTTGCTTTGGGGCATGG - Intronic
985475079 5:74287-74309 AGGGTCTTTGCTGGGGAACTGGG + Intergenic
985946895 5:3192623-3192645 AACGTTTTTGCAGGTGGACAAGG - Intergenic
987927990 5:24365852-24365874 AAGGTCTTTGCTGGGGGTGAGGG - Intergenic
988169601 5:27636613-27636635 AAGATGTTTGCTGGGAGGCTAGG + Intergenic
990748060 5:58981697-58981719 GAGGTGCTTGCTGAGGGAAAAGG - Intronic
990867636 5:60397618-60397640 ATGGTGTTTACTGGGGGCTAGGG + Intronic
992015380 5:72569980-72570002 CAGGGGCCTGCTGGGGGACACGG - Intergenic
993780930 5:92064326-92064348 AAGGTGTTTGCTGTAGGCAAAGG + Intergenic
994994030 5:107036835-107036857 AAGGTATGTGTTGGGGGACTGGG + Intergenic
996216299 5:120870811-120870833 AAGTTGTTGGGTGGAGGACAGGG + Intergenic
997198114 5:131993106-131993128 CAGGTGTGTGCTGAGGCACATGG - Intronic
998599005 5:143565562-143565584 AAGGTGTTGCTTTGGGGACATGG - Intergenic
999265284 5:150263019-150263041 AAGGTGTTGGTTGGGGAAGAGGG + Intronic
999798678 5:155012015-155012037 AAAGTGGTTGCTGGGGGAATGGG - Intergenic
1000116729 5:158160757-158160779 AATGTGGTTGCTGTGAGACAAGG - Intergenic
1001763173 5:174224018-174224040 AAGGTTTGGGCTGGGGGACAGGG + Intronic
1004918842 6:20357329-20357351 AAGGTGTATGCTGTGGGTCAGGG + Intergenic
1005218850 6:23563003-23563025 AAGGAGTTTTTTGGGGGAAAGGG + Intergenic
1006144755 6:31952029-31952051 AAGGGGTTTCCTGCTGGACAGGG + Exonic
1006957362 6:37885781-37885803 AATTTGTTTGCTTGGGGAGAGGG + Intronic
1007212625 6:40207698-40207720 AAGGGGTTTGTTGGGGTATATGG - Intergenic
1007262144 6:40571486-40571508 ATGGGGTTTGCTGGGGGTTAGGG - Intronic
1008543214 6:52563715-52563737 AAAGTGGTTACTTGGGGACAGGG + Intronic
1011286708 6:85732410-85732432 ATGATGTTAGCTGGTGGACATGG + Intergenic
1015441261 6:133249692-133249714 AAGATATTTGCAGGGGGAGAGGG - Intronic
1016921621 6:149300667-149300689 AAGGTGTGTGTTGGGGAAGAGGG - Intronic
1017915139 6:158825809-158825831 ACGGTTGTTGCTGGGGGAAAAGG - Intergenic
1018654681 6:166024186-166024208 AAGGAGTGAGGTGGGGGACAGGG + Intergenic
1019582260 7:1770667-1770689 AAGGTGTTAGCTGTGAGCCAAGG - Intergenic
1021372183 7:19862606-19862628 AATGCTTTTACTGGGGGACAGGG - Intergenic
1021432393 7:20575585-20575607 AATGTGTTTGCTGGGTCCCAGGG - Intergenic
1023295468 7:38710733-38710755 AGGCTGTTGGCAGGGGGACAGGG - Intergenic
1023920136 7:44622772-44622794 AAGGTGCTTGCTGGCCTACATGG - Intronic
1024383003 7:48721408-48721430 AAGGTGTTTGCTTTGGGAAAAGG + Intergenic
1026104287 7:67408852-67408874 AAAGTGTGGTCTGGGGGACAGGG + Intergenic
1026625960 7:71992643-71992665 AAGGTCTTTGCTGGGTGCGATGG - Intronic
1027052269 7:75027882-75027904 CAGGAGATAGCTGGGGGACAAGG - Intronic
1027799970 7:82738219-82738241 GAGGTGTTTGCTGAAGGCCAAGG + Intergenic
1028532498 7:91852765-91852787 CAGGTGTTTTCAGGGGGCCAAGG - Intronic
1031484038 7:122307174-122307196 AAGGGCTTTGCTGGGGCAAAGGG + Intronic
1032674669 7:134118320-134118342 ATGGTGTTTGCCAGGGAACAGGG + Intergenic
1034266115 7:149781493-149781515 ACTGTGTTTGCTGGGGGAGATGG - Intergenic
1034914020 7:155022092-155022114 AAGGTGCTTGCTGTGGGCAAAGG + Intergenic
1035616701 8:1007290-1007312 GAGGGGTTTGCTGGAGGACCTGG + Intergenic
1035708354 8:1694811-1694833 CATGAGTTTGCTGGGGGAAAGGG + Intronic
1037383395 8:18312178-18312200 AATGTGTTTGCTGAGGGGAAAGG + Intergenic
1039718071 8:40132539-40132561 AAGGGGGTTGTGGGGGGACAGGG + Intergenic
1041664838 8:60433310-60433332 AATGTGATTGCTGGGGTAAATGG + Intergenic
1041774980 8:61513910-61513932 AAGGTGTTTGCTGGGAGCCTGGG + Intronic
1042046984 8:64664188-64664210 CACGTGTGTGCTGGGGGAGATGG + Intronic
1042809418 8:72807321-72807343 AAGCTGTTTTCTGGGATACAAGG + Intronic
1042903180 8:73747535-73747557 CTGGTGTTTGCTGGGCGAGACGG - Intronic
1043130564 8:76455826-76455848 CAGGTGTTTGCTGGGGGCTGGGG + Intergenic
1043298695 8:78699984-78700006 AATGGGATTGCTGGGGGAAATGG + Intronic
1043881809 8:85552453-85552475 AAGGTGTTTCCTAAGGGAAAAGG - Intergenic
1044486900 8:92765238-92765260 AAGGTGTTTGCTGAAGGCAAAGG - Intergenic
1045218230 8:100170545-100170567 ATGGTGGTTGCTAGGGGACAGGG - Intronic
1045242260 8:100412917-100412939 AAGGTGTGTGCTGGGGGTGGGGG - Intergenic
1046280854 8:112028982-112029004 AAGCTGTTATCTGGGAGACACGG - Intergenic
1048817785 8:138350128-138350150 AAGGAGTTTGCTTGGGGACTGGG - Intronic
1049037073 8:140085104-140085126 AAGGTGTTTGCAGTGAAACATGG - Intronic
1049142883 8:140973289-140973311 CTGGTGTTTGCTGTGGGTCAGGG - Intronic
1049203990 8:141354937-141354959 AAGGACGTGGCTGGGGGACAGGG - Intergenic
1049296461 8:141842984-141843006 AAGATGTTTTCTGGAGCACATGG + Intergenic
1052611347 9:30778640-30778662 AAGGTATTTGTTGGGGGAATTGG - Intergenic
1052615319 9:30831882-30831904 AAGGGCTTTGGTGGGGGACGTGG + Intergenic
1052999524 9:34569959-34569981 TAGGTGTGTGCTGGGGGAGGGGG - Intronic
1053168930 9:35864683-35864705 AAAATATTTGCTGGGGGACAGGG - Intergenic
1056091526 9:83210231-83210253 AAGGGGTTTGGAGGGGGCCAAGG + Intergenic
1056317322 9:85402510-85402532 ATGCTGGTTGCTGGTGGACAGGG - Intergenic
1056543989 9:87597850-87597872 AAGGTGTGTGTTTAGGGACAGGG - Intronic
1056994018 9:91438028-91438050 AAGGGGGTTGCTGGGCCACATGG + Intergenic
1058618217 9:106858932-106858954 AAGGTGTTTATGGGGGGAAAGGG - Intergenic
1060335819 9:122720925-122720947 ATTGTGTTTGCTGGGGGTGAAGG - Intergenic
1061089107 9:128416786-128416808 GAGATCTTTGCTGGGGGAGAGGG + Intronic
1062172054 9:135140306-135140328 TTGCTGTTTGATGGGGGACACGG + Intergenic
1062717994 9:138020790-138020812 CAGGTGTTTCCTGGGCGAGAAGG + Intronic
1185982347 X:4793462-4793484 AATGTCTTTCCTGGAGGACAGGG - Intergenic
1186033857 X:5399437-5399459 AAGGAGTTTGTTTTGGGACAGGG - Intergenic
1186213606 X:7276004-7276026 AAAGTCTTTGCTGGAGAACAGGG - Exonic
1186449803 X:9662538-9662560 AGGGTGGTTGCTGGGGGATGGGG + Intronic
1187428605 X:19201674-19201696 ATGGTTTTTACTGGGGGAGAGGG + Intergenic
1189972443 X:46431935-46431957 GAGGTGTTTGCTGAGGGCAAAGG + Intergenic
1190514694 X:51211116-51211138 AATGTGATTGCTGGGTCACATGG + Intergenic
1190699848 X:52979534-52979556 CAGGTGTGTGCTGTGGGAGAAGG - Intronic
1190938660 X:55019455-55019477 AAGTTGTCTGCTGAGGGAGATGG + Intronic
1191217791 X:57951513-57951535 CAGCTGTTTGGTGGGGGAGAGGG - Intergenic
1191927101 X:66325231-66325253 ATGGTGGCTGCTGGGGGAAAAGG + Intergenic
1191966160 X:66760808-66760830 AAGATTTTGGCTGGGGCACATGG + Intergenic
1192638917 X:72845371-72845393 AAGGAGAGAGCTGGGGGACAGGG + Intronic
1192642795 X:72875437-72875459 AAGGAGAGAGCTGGGGGACAGGG - Intronic
1193490619 X:82144117-82144139 CAGGGCTTTGCTGGGGGCCATGG - Intergenic
1195288322 X:103406986-103407008 AATGTGTTTGCCTGGAGACAGGG - Intergenic
1195909926 X:109878835-109878857 TAGGAGTTTGCTGGGGGATAAGG + Intergenic
1196429076 X:115603039-115603061 AAGGTATTTGAAGGGGGACGGGG - Intronic
1198414394 X:136405298-136405320 AAGGTGGTGGCGGGGGGGCAGGG + Intronic
1199598366 X:149525639-149525661 AAGCTGTTTGCTAGGGGCCTCGG + Intronic
1200167377 X:154046231-154046253 AGGGTGGTTTCTGGGGGACGGGG - Intronic
1200246674 X:154530223-154530245 AAGGAGCTTGATGGGGGCCAAGG - Intergenic
1201523152 Y:14899602-14899624 AAAGTGTTTGCTGTTAGACAAGG + Intergenic