ID: 1071433543

View in Genome Browser
Species Human (GRCh38)
Location 10:85625613-85625635
Sequence CTTGCTAAGGTGTTTGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 400}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071433543_1071433550 9 Left 1071433543 10:85625613-85625635 CCCCCAGCAAACACCTTAGCAAG 0: 1
1: 0
2: 3
3: 57
4: 400
Right 1071433550 10:85625645-85625667 TTCTCAGTCTACCTGCTCCCTGG No data
1071433543_1071433551 10 Left 1071433543 10:85625613-85625635 CCCCCAGCAAACACCTTAGCAAG 0: 1
1: 0
2: 3
3: 57
4: 400
Right 1071433551 10:85625646-85625668 TCTCAGTCTACCTGCTCCCTGGG No data
1071433543_1071433553 23 Left 1071433543 10:85625613-85625635 CCCCCAGCAAACACCTTAGCAAG 0: 1
1: 0
2: 3
3: 57
4: 400
Right 1071433553 10:85625659-85625681 GCTCCCTGGGTTGTTGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071433543 Original CRISPR CTTGCTAAGGTGTTTGCTGG GGG (reversed) Intronic
900230901 1:1556892-1556914 CTGGCTGAGGTAGTTGCTGGTGG - Intronic
904578028 1:31518060-31518082 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
906050758 1:42869375-42869397 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
906879933 1:49578422-49578444 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
906930645 1:50166558-50166580 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
907780655 1:57563120-57563142 CCTGCTGAGGTGTTTGCTGAAGG + Intronic
907830275 1:58058366-58058388 CATGCAATGGGGTTTGCTGGTGG - Intronic
908052590 1:60248667-60248689 CCTGCTGAGGTGTTTGCTGAAGG + Intergenic
909233511 1:73121313-73121335 CCAGCTAAGGTGCTTGCTGAGGG + Intergenic
909548666 1:76875215-76875237 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
909577333 1:77188884-77188906 CTTGTTAAGGTGCTTGCTGAAGG + Intronic
909858648 1:80575076-80575098 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
910318266 1:85914160-85914182 CTAGCTGAGGTGCTTGCTGATGG + Intronic
910413601 1:86973064-86973086 CTTGTTAAGGTGGTTTCTGCTGG + Intronic
910562167 1:88601925-88601947 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
910588493 1:88903688-88903710 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
910630483 1:89348223-89348245 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
910790563 1:91045401-91045423 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
910948490 1:92618673-92618695 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
911256476 1:95638930-95638952 CTTGCCATGGTGTTTACTGTGGG + Intergenic
911257061 1:95645396-95645418 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
911403631 1:97408199-97408221 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
911974450 1:104473631-104473653 CTTGCTAAGGTGCTTGCTGAAGG + Intergenic
912067274 1:105758897-105758919 CCTGCTGAGGTGCTTGCTGCAGG + Intergenic
912129647 1:106586090-106586112 ACTGCTGAGGTGTTTGCTGAAGG - Intergenic
913559435 1:120002546-120002568 CCTGCTGAGGTGTTTGCTGAAGG + Intronic
913638426 1:120787994-120788016 CCTGCTGAGGTGTTTGCTGAAGG - Intergenic
913667131 1:121058654-121058676 CTTGCACAGGTGACTGCTGGCGG - Intergenic
914018822 1:143845806-143845828 CTTGCACAGGTGACTGCTGGCGG - Intergenic
914280025 1:146161968-146161990 CCTGCTGAGGTGTTTGCTGAAGG + Intronic
914541070 1:148612907-148612929 CCTGCTGAGGTGTTTGCTGAAGG + Intronic
914625572 1:149458339-149458361 CCTGCTGAGGTGTTTGCTGAAGG - Intergenic
914657375 1:149754009-149754031 CTTGCACAGGTGACTGCTGGCGG - Intergenic
914875305 1:151509220-151509242 ATTGCTAAGGTGTTATCTAGGGG + Intergenic
917462974 1:175248120-175248142 CTTGCTGAGGTGCTTGCTGAAGG + Intergenic
917764804 1:178203975-178203997 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
918774763 1:188612704-188612726 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
919124109 1:193376025-193376047 CCTGCTGAGGTGTTTGCTGGAGG - Intergenic
919134797 1:193494231-193494253 TTAGCCAAGGTGTTTGCTAGTGG + Intergenic
919242077 1:194926476-194926498 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
919330469 1:196163831-196163853 CTGGCTGAGGTGCTTGCTGAAGG + Intergenic
919616766 1:199817585-199817607 CTTGCTAAGTTGTTTGCTTTTGG - Intergenic
920197709 1:204240321-204240343 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
921343671 1:214159590-214159612 CTTTCTCAGGTAGTTGCTGGAGG + Intergenic
923957516 1:239039616-239039638 CTTGCTGAGGTGCTTGCTGAAGG + Intergenic
924182293 1:241451304-241451326 CCAGCTGAGGTGTTTGCTGAAGG - Intergenic
924326269 1:242896904-242896926 TTTTCTCATGTGTTTGCTGGCGG + Intergenic
1062916049 10:1241875-1241897 GCTGCAAAGGTGTTTTCTGGAGG + Intronic
1063788387 10:9410500-9410522 CTTGCTGAGGTGCTTGCTGAAGG + Intergenic
1065631465 10:27685198-27685220 CTTGCCATGGTCTTTGCAGGTGG - Intronic
1066169815 10:32829280-32829302 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
1066333647 10:34453096-34453118 CTACCTATAGTGTTTGCTGGAGG - Intronic
1066957884 10:42189976-42189998 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1067125223 10:43510273-43510295 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1068447464 10:57140555-57140577 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1069192035 10:65504407-65504429 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1070120878 10:73575554-73575576 ATTGCTGAGGCCTTTGCTGGGGG + Exonic
1070496288 10:77026920-77026942 GTTATTAAGGTGTTTGTTGGAGG + Intronic
1070573559 10:77660099-77660121 CTTGCTGAGGGGTTTGCAGAGGG + Intergenic
1070599694 10:77857114-77857136 CTTGCTGGGGTGGTTACTGGGGG - Intronic
1071033017 10:81206737-81206759 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1071266803 10:83972037-83972059 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1071378651 10:85035325-85035347 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1071433543 10:85625613-85625635 CTTGCTAAGGTGTTTGCTGGGGG - Intronic
1071937952 10:90551219-90551241 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1071942509 10:90605817-90605839 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1072208988 10:93229737-93229759 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1073557633 10:104467861-104467883 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1073656399 10:105422526-105422548 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1073995608 10:109312823-109312845 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1078351174 11:10594761-10594783 CATACTCAGGTGTTTCCTGGTGG - Intronic
1078799119 11:14624909-14624931 CTTGCCAAGGTGATAGCTGAGGG + Intronic
1080076870 11:28159466-28159488 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
1081630916 11:44688993-44689015 CTACCTAAGGTGTGTGCTGGAGG - Intergenic
1082715487 11:56606772-56606794 CCTGCTAAGGTGCTTGCTGAAGG + Intergenic
1082999920 11:59281805-59281827 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1083112219 11:60422570-60422592 CCAGCTAAGGTGTTTGCTGAAGG - Intergenic
1083313532 11:61799455-61799477 CTTGCCTTGGTGTTTTCTGGAGG + Intronic
1085439194 11:76542705-76542727 CTTGTTTAGCTGTTTGCTGCTGG + Intronic
1085686238 11:78624127-78624149 CTTGCTGAGGTGCTTTCTGAAGG + Intergenic
1085951467 11:81337487-81337509 CTTGGAAAGGTAGTTGCTGGGGG + Intergenic
1086141359 11:83504241-83504263 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
1086278878 11:85162415-85162437 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
1086703223 11:89923611-89923633 ATTGCTAATGTGTTGGCTGCTGG - Intergenic
1086805594 11:91238197-91238219 TTTGCTTAGGTGTTTTCTTGTGG + Intergenic
1087996665 11:104817528-104817550 CTTGCTAAGGTGTATGGACGAGG + Intergenic
1088157812 11:106829938-106829960 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
1088265708 11:107985553-107985575 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1088407338 11:109496721-109496743 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1089903889 11:122015556-122015578 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1090168562 11:124577889-124577911 CTTGAGCAGGTCTTTGCTGGAGG - Intergenic
1090209211 11:124906115-124906137 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1092148762 12:6232769-6232791 CCTGCTGAGGTTTTTGTTGGTGG - Intronic
1093031536 12:14293676-14293698 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1093645983 12:21585586-21585608 CCTGCTGAGGTGCTTGCTGAGGG + Intronic
1093975085 12:25412851-25412873 CTTCCTGAGGTGTGTGCAGGAGG - Intronic
1093981346 12:25478849-25478871 CCTGCTGAGATGTTTGCTGAAGG - Intronic
1094102802 12:26781202-26781224 CATGCTGAGGTGTTTGCTGAAGG + Intronic
1095604169 12:44046583-44046605 CCTGCCAAGGTGCTTGCTGAAGG + Intronic
1095844126 12:46728025-46728047 CCTGCTGAGGTGTTTGCTGAAGG - Intergenic
1095855982 12:46861744-46861766 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1095984990 12:47993549-47993571 CTTCCCTAGGAGTTTGCTGGCGG - Intronic
1096090841 12:48899761-48899783 CCTGTTAAGGTGCTTGCTGAAGG + Intergenic
1096289044 12:50325190-50325212 CCTGCTGAGGTGTTTGCTGAAGG + Intergenic
1097077271 12:56404333-56404355 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1097437561 12:59570322-59570344 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1097640680 12:62177725-62177747 CTGGCTTAGGTGACTGCTGGGGG - Intronic
1097821075 12:64129948-64129970 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
1097843070 12:64340812-64340834 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
1098731365 12:74039645-74039667 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1098750097 12:74281535-74281557 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1099183113 12:79490474-79490496 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1099578313 12:84407334-84407356 CCTGCTGAGGTGTTTGCTGCAGG + Intergenic
1099632474 12:85168139-85168161 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
1099700619 12:86077619-86077641 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
1100965344 12:100006943-100006965 CTTGCTCAGTTGTTGGCTGAAGG + Intergenic
1101264407 12:103068064-103068086 CCTGCTGAGGTGTTTCCTGAAGG + Intergenic
1101534339 12:105603817-105603839 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1103035903 12:117656009-117656031 CTTGCTGAGGTGCCTGCTGAAGG + Intronic
1104407580 12:128531120-128531142 TTTGCTAAAGTTTTTGCTGTAGG + Intronic
1105740441 13:23317409-23317431 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
1106628162 13:31442128-31442150 CTTGCCATGGAATTTGCTGGCGG - Intergenic
1107505417 13:41028466-41028488 CCAGCTAAGGCGTTTGCTGAAGG + Intronic
1107983312 13:45754023-45754045 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1108914043 13:55586965-55586987 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1111198800 13:84906827-84906849 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1111317757 13:86583739-86583761 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1111363348 13:87207061-87207083 CTTGCTGAGGCGCTTGCTGAAGG - Intergenic
1111536042 13:89604671-89604693 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1112787271 13:102964908-102964930 CTTACTCAGGTGTTTACTGTGGG + Intergenic
1112832565 13:103471767-103471789 CTTGCTGAGGTGCTTGCTGAAGG - Intergenic
1113319434 13:109219729-109219751 CCTGCTGAGGGGCTTGCTGGAGG - Intergenic
1114206143 14:20572714-20572736 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1115130951 14:30051202-30051224 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
1116068354 14:40011096-40011118 CTTGCTGAAGTGCTTGCTGAAGG + Intergenic
1116218776 14:42054466-42054488 CTTGCTGAGGTGCTTGCTAAAGG + Intergenic
1116531203 14:45976295-45976317 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1117217120 14:53562098-53562120 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1117595999 14:57327937-57327959 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1117634398 14:57726317-57726339 CTTGCTGAGGTGCTTGATGAAGG + Intronic
1118950492 14:70432635-70432657 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1119107279 14:71936907-71936929 CCTGCTGAGGTGCTTGCTGTAGG - Intronic
1119569255 14:75655544-75655566 GTTTCTTTGGTGTTTGCTGGGGG + Intronic
1119987215 14:79151384-79151406 CTTGCTATGGTTTTTGCAGCTGG - Intronic
1120081759 14:80225640-80225662 CCTGCTGAGGTGTTTGCTGAAGG - Intronic
1120350614 14:83352866-83352888 CCTTCTGAGGTGCTTGCTGGAGG + Intergenic
1120555758 14:85928706-85928728 CTTGCTGAGGTGCTTGCTGAAGG - Intergenic
1122093270 14:99353701-99353723 CTTAGAAAGGTGTTTTCTGGGGG - Intergenic
1122763972 14:104052099-104052121 CTTCCTGAGGGGTGTGCTGGAGG - Exonic
1126073380 15:44885537-44885559 CTTGGTAAGGTGTTAGCTTGTGG + Intergenic
1126283868 15:46988183-46988205 CTTGCTGAGGTGCTTGCTGAAGG + Intergenic
1126867427 15:52951491-52951513 GTTGCTCAGTTCTTTGCTGGTGG + Intergenic
1127139421 15:55959803-55959825 CAAGCTAATGTGGTTGCTGGTGG - Intronic
1127307714 15:57724315-57724337 CTAGCTAAGGTCTTTGATGAAGG + Intronic
1127357054 15:58210173-58210195 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
1127473963 15:59314829-59314851 CTGGCTTAGGTGACTGCTGGAGG + Intronic
1131724277 15:95204739-95204761 TTTGCTGAGGTGCTTGCTGAAGG + Intergenic
1131967037 15:97855185-97855207 CCTGCTGAGGTATTTGCTGAAGG + Intergenic
1132217881 15:100080565-100080587 CTTGCTGAGGTGCTTGCTGAAGG + Intronic
1133697824 16:8281656-8281678 GTTGCTTGGGTGTTTGTTGGTGG - Intergenic
1141559259 16:84856095-84856117 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
1141804013 16:86330819-86330841 TTTGATAAGGTATTTCCTGGAGG + Intergenic
1203141642 16_KI270728v1_random:1771213-1771235 TTTGCTAAGGTGGTTTCAGGAGG + Intergenic
1145014878 17:19390135-19390157 CCTTCTAAGGTGTTGTCTGGAGG + Intergenic
1146238301 17:31188164-31188186 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
1146477045 17:33171466-33171488 CTTGGTAATGTGTTGGATGGGGG - Intronic
1148635416 17:49145570-49145592 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
1149468985 17:56901095-56901117 CTTGTTATTGTGTTTGGTGGGGG - Intronic
1149523569 17:57336993-57337015 CTTGCAGGGTTGTTTGCTGGAGG + Intronic
1149726554 17:58900412-58900434 CGTGATAAGCTTTTTGCTGGTGG - Intronic
1151037537 17:70819674-70819696 CCTGCTGAGTTGCTTGCTGGAGG - Intergenic
1151111766 17:71686691-71686713 ATTGCTAAGGTGTTTGATTATGG + Intergenic
1152434548 17:80267772-80267794 CTGGCTAAGGTTATTGATGGAGG + Intronic
1152823845 17:82451001-82451023 CTTGGTAAGTTCTTTGCTGTCGG - Intergenic
1153089992 18:1332094-1332116 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1153217408 18:2833671-2833693 CCTGCCGAGGTGTTTGCTGACGG - Intergenic
1153224656 18:2890097-2890119 CTTGCTAAAGTGGTTTCTTGTGG + Intronic
1153287999 18:3474134-3474156 CTTGCTAAGGTAATTGATGAAGG + Intergenic
1154252291 18:12754819-12754841 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1154506421 18:15044814-15044836 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1155384721 18:25265234-25265256 CTTGCTCAGGTGTTGACTGTTGG + Intronic
1156469231 18:37367136-37367158 TGTGCTAAGGTGTTTGCAGGAGG + Intronic
1156891061 18:42189692-42189714 GATGCTAAGGAGTGTGCTGGAGG + Intergenic
1156990048 18:43398848-43398870 CTTGCTGAAGTGCTTGCTGAAGG - Intergenic
1156998844 18:43499661-43499683 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1159151650 18:64530760-64530782 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1160092715 18:75841954-75841976 CCTGCTGAGGTGCTTGCTGAGGG + Intergenic
1162070805 19:8151170-8151192 GTTGCATAGGAGTTTGCTGGAGG + Intronic
1166637303 19:44461666-44461688 CTTACAATGGTGTTGGCTGGGGG - Intergenic
1168539059 19:57195472-57195494 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
925105280 2:1285760-1285782 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
925280224 2:2678789-2678811 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
925461008 2:4062386-4062408 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
925499137 2:4484955-4484977 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
925639845 2:5976863-5976885 CTTGCTAATGTGATTGTGGGTGG - Intergenic
926827032 2:16915601-16915623 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
927008987 2:18881645-18881667 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
930480902 2:51947327-51947349 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
930536354 2:52650309-52650331 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
932870419 2:75393146-75393168 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
934306001 2:91822493-91822515 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
934327255 2:92030249-92030271 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
934465637 2:94260829-94260851 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
934513750 2:94970641-94970663 CTGGCTGAGCTGCTTGCTGGGGG - Intergenic
935134146 2:100284566-100284588 CTTGCTCACGTGTCTGTTGGTGG - Intronic
935311192 2:101785315-101785337 CTTGCTAAGATGTGAGGTGGTGG + Intronic
935424845 2:102909496-102909518 CCTGCTAAGGTGCTTGCTGAAGG - Intergenic
935763714 2:106344326-106344348 CTTGATAATGTGTTTGCTTTTGG + Intergenic
937906827 2:127056556-127056578 TGTGTGAAGGTGTTTGCTGGAGG + Intronic
938543606 2:132306733-132306755 CTTACGATGGTGTTGGCTGGGGG - Intergenic
938942757 2:136183316-136183338 CTGGCTATTGTGTTTGCTGAAGG + Intergenic
940140811 2:150488597-150488619 CTTTCTAAGATTTTTGCTTGCGG - Intronic
940171048 2:150830761-150830783 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
941203972 2:162548380-162548402 CTTCCAAAGGTGGTTGCAGGAGG + Intronic
941387051 2:164866513-164866535 CCTGCTAAGGTGCTTGCTTAAGG + Intergenic
941668299 2:168263031-168263053 CCTGCTGAGGTGCTTGCTGAGGG + Intergenic
942322208 2:174745475-174745497 CCAGCTGAGGTGCTTGCTGGAGG + Intergenic
942423584 2:175835240-175835262 CTTGTTAAAGTGTTTGCTTTGGG + Intergenic
942497059 2:176550909-176550931 CTTGGTAATGTCTTTGATGGAGG + Intergenic
943383805 2:187179153-187179175 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
943517317 2:188905284-188905306 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
944541229 2:200755629-200755651 ACTCCTAAGGTGTGTGCTGGTGG - Intergenic
945577132 2:211545683-211545705 CATGCTAATGTGCTTGCTTGGGG + Intronic
945725581 2:213469548-213469570 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
946533848 2:220605947-220605969 ATTGCTGAGGTGCTTGCTGAAGG - Intergenic
1170006329 20:11673439-11673461 CTAGCTGAGGTGCTTGCTGAGGG + Intergenic
1171795786 20:29565971-29565993 CTGTCTAAGGTGTGTGGTGGTGG + Intergenic
1171872471 20:30539439-30539461 CTTACGATGGTGTTGGCTGGGGG - Intergenic
1172285816 20:33739677-33739699 CTGGCTAACGTGATTTCTGGAGG + Intronic
1172525269 20:35597181-35597203 CTTGCTAAGATTTTGGCTTGTGG - Intergenic
1173603363 20:44311429-44311451 CTTGTGAAAGTATTTGCTGGAGG + Intergenic
1176791434 21:13324209-13324231 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1176998432 21:15582189-15582211 CCTGCTGAGGTGCTTGCTGATGG + Intergenic
1177139154 21:17340330-17340352 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1177505287 21:22012283-22012305 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1177913446 21:27058158-27058180 CCTGCTCAGGTGCTTGCTGAAGG + Intergenic
1177990353 21:28029107-28029129 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1178242771 21:30921834-30921856 CCTGCTAAGGTCTATGCAGGAGG - Intergenic
1179414865 21:41190594-41190616 CCTGCCAAGGTGTTTGCTGAAGG - Intronic
1180279565 22:10681478-10681500 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1180586778 22:16900008-16900030 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1180725844 22:17945973-17945995 CTTGATAAGGTGATTGCTTTCGG - Intronic
1181373452 22:22437239-22437261 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1182965954 22:34521016-34521038 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1183436020 22:37795724-37795746 CTTGCTAAAGGGTTGGCTGTGGG - Intergenic
1185355190 22:50364729-50364751 TGTGCAAAGGTGTTAGCTGGGGG + Intronic
949246146 3:1926832-1926854 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
949417321 3:3828950-3828972 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
949639173 3:6015460-6015482 TCTGCTGAGGTGTTTGCTGAAGG + Intergenic
949918056 3:8980470-8980492 ATTTCAAAGGTGTTTCCTGGGGG + Intergenic
951291085 3:20873111-20873133 CCTGCTGAGGTGTTTGCTGAAGG - Intergenic
951384791 3:22029456-22029478 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
954511222 3:51127750-51127772 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
954979545 3:54732355-54732377 CTTGCTAATGTGTTCTTTGGTGG + Intronic
955234065 3:57124179-57124201 ATTGCTAAGGTGGTTTCTGAGGG - Intronic
956047899 3:65215770-65215792 CAAGCTGAGGTGTTTGCTGAGGG + Intergenic
956863709 3:73349217-73349239 CATGCTATGGTGTTTGGCGGGGG + Intergenic
958499659 3:94888829-94888851 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
959433017 3:106278230-106278252 CTTGCTAGGGTGTTTTGTGATGG - Intergenic
959745752 3:109775340-109775362 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
960872233 3:122261541-122261563 GTTGCTGAGGAGTCTGCTGGAGG - Exonic
961562189 3:127738375-127738397 CTTGCTCCTGTGTTTGCTGGAGG - Intronic
963226686 3:142869441-142869463 CTTGCAAAGCTGTCTGTTGGGGG + Intronic
963331543 3:143921461-143921483 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
963355383 3:144204919-144204941 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
964146776 3:153473275-153473297 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
965291491 3:166887649-166887671 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
965510577 3:169564592-169564614 CTTGCTAAAGTATTTTTTGGGGG - Intronic
965892940 3:173537650-173537672 CTAGCTGAGGTGCTTGCTGAAGG - Intronic
965958194 3:174396814-174396836 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
965995950 3:174883734-174883756 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
966044064 3:175528973-175528995 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
967832062 3:193927925-193927947 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
967846127 3:194044671-194044693 CTTGCTAAGCTGGATGCTGTGGG + Intergenic
968315958 3:197725822-197725844 CATGCTAAGGAGTTTGTTGGTGG - Intronic
969389250 4:6878630-6878652 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
970524236 4:16914981-16915003 CCAGCTGAGGTGTTTGCTGAAGG + Intergenic
970629735 4:17927073-17927095 CTAGCTAAGGTCTTTGATGAAGG - Intronic
971126707 4:23762244-23762266 CCTGCTGAGGTGTTTGCTGAAGG + Intronic
972806202 4:42531311-42531333 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
973103176 4:46296680-46296702 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
974817268 4:67021506-67021528 CATGCTAAGGTGCTTGGTGTGGG - Intergenic
975982345 4:80175336-80175358 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
976033947 4:80793905-80793927 CTTTCTGAGGTGCTTGCTGAGGG - Intronic
977031948 4:91894129-91894151 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
977431030 4:96930132-96930154 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
977701480 4:100027967-100027989 CCTGCTAAGGTGCTTGATGAAGG - Intergenic
977832960 4:101615902-101615924 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
977898970 4:102396528-102396550 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
979767239 4:124476228-124476250 CCTGCTGAGGTGTTTGCTGAAGG + Intergenic
980405632 4:132351854-132351876 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
980497369 4:133604134-133604156 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
980602479 4:135041944-135041966 CCTGCTGGGGTGTTTGCTGAAGG + Intergenic
980958060 4:139448249-139448271 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
981452633 4:144916286-144916308 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
981727730 4:147864963-147864985 ATTGCCAAGTTGTTTGCTGGTGG + Intronic
982481920 4:155922454-155922476 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
982772229 4:159407180-159407202 CTAGCTAAGGTGCTTACTGAAGG + Intergenic
983027670 4:162757222-162757244 CCTGCTGAGGTGCTTGCTGATGG + Intergenic
983582964 4:169326787-169326809 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
983785236 4:171721695-171721717 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
984904830 4:184616967-184616989 CCTGCAAAGGTGTCTGGTGGGGG - Intergenic
985832591 5:2245273-2245295 CTTGCTGAGGTGCTTGCTGAAGG + Intergenic
986147369 5:5091329-5091351 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
986261367 5:6150557-6150579 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
986743214 5:10721688-10721710 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
987466364 5:18276426-18276448 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
987927993 5:24365858-24365880 TGTGCCAAGGTCTTTGCTGGGGG - Intergenic
988168951 5:27630911-27630933 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
988205036 5:28123383-28123405 CTTCCTGAGGTGCTTGCTGAAGG - Intergenic
988562406 5:32292774-32292796 CCTGCTGAGGTGTTTGCTGAAGG + Intronic
988785260 5:34561018-34561040 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
989044878 5:37265344-37265366 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
989307235 5:39972683-39972705 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
989486113 5:41994452-41994474 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
991033827 5:62107857-62107879 CCTGCTGAGGTGTTTGCTGAAGG + Intergenic
991234388 5:64377019-64377041 CCAGCTAAGGTGATTGCTGAGGG + Intergenic
991565023 5:67996576-67996598 CTTGGTCAGGTGTGTGGTGGAGG - Intergenic
992515227 5:77484966-77484988 CTTGCTTAGTTATTTGCTGAGGG - Intronic
993367073 5:87047927-87047949 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
994291104 5:98030020-98030042 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
994604971 5:101955528-101955550 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
995095593 5:108231987-108232009 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
996825829 5:127679755-127679777 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
998209957 5:140188230-140188252 CTTGCTAATTTTTTTGCGGGGGG + Intronic
998290061 5:140906618-140906640 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
998452653 5:142246714-142246736 CTTCCTCTGGTGTTTTCTGGGGG - Intergenic
999487497 5:152013195-152013217 ATTGCTACGGTGATTGGTGGTGG + Intergenic
1000417281 5:160996139-160996161 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1005185435 6:23158999-23159021 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1005873722 6:29995944-29995966 TTTGCTAATCTTTTTGCTGGGGG - Intergenic
1006062607 6:31435134-31435156 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1008400536 6:51057370-51057392 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1008807920 6:55454341-55454363 CTTTCAAAGGTGTATACTGGAGG + Intronic
1009389860 6:63133138-63133160 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1009701023 6:67181276-67181298 CTTGCTAAGCTGTATGGTGGTGG - Intergenic
1011039088 6:83011370-83011392 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
1011069365 6:83363589-83363611 CCTGCTGAGGTGTTTGCTGAAGG + Intronic
1012421622 6:99072012-99072034 CTTGCCAAGGTGATAGCTGAGGG + Intergenic
1012730697 6:102876215-102876237 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1012977985 6:105800405-105800427 CTTGCTTAGGTGCTGGCTGGGGG - Intergenic
1013244705 6:108275395-108275417 GTTGGTAAGGGGTTTGCAGGAGG - Intergenic
1013406936 6:109851676-109851698 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1013712920 6:112922431-112922453 CTAGCTAAGATGTTTGATGAAGG + Intergenic
1014363138 6:120506405-120506427 CCTGCTGAGGTGGTTGCTGAAGG - Intergenic
1014414967 6:121172566-121172588 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
1014631898 6:123798738-123798760 CCTGCTAAGGTGCTTGCTGAAGG + Intergenic
1015262877 6:131258523-131258545 TTTGCTAAGATGTTTGCTGTAGG - Intronic
1015476030 6:133659447-133659469 CCTGCTAAGGTGCTTGCTGAAGG + Intergenic
1016119677 6:140330747-140330769 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1016324113 6:142880221-142880243 CATTCTACTGTGTTTGCTGGTGG - Intronic
1016575999 6:145570648-145570670 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
1017452600 6:154567624-154567646 CCAGCTAAGGTGCTTGCTGAAGG + Intergenic
1018425522 6:163676810-163676832 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1018600155 6:165529468-165529490 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
1018902251 6:168057491-168057513 CTCGCAGAGGTGTGTGCTGGGGG - Intronic
1019151357 6:170008030-170008052 CCTGCTAACTTGGTTGCTGGAGG + Intergenic
1020115173 7:5472181-5472203 CTTGCTGAGGGGCGTGCTGGGGG - Intronic
1020567505 7:9816910-9816932 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1020671069 7:11113092-11113114 TTTCCTAACTTGTTTGCTGGGGG - Intronic
1021523411 7:21559205-21559227 TTTGCTAATGGGTTTGCTAGAGG - Intronic
1021622592 7:22563355-22563377 CTTCCTAATGTGGTTGCTGCTGG - Intronic
1021634510 7:22678512-22678534 CTAGCTGAGCTGTTTGCTGGGGG + Intergenic
1022079113 7:27001925-27001947 ATTGTTATGGTGTTTCCTGGTGG - Intergenic
1024040817 7:45552085-45552107 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1024467243 7:49724308-49724330 GTTGTTAAGGTGTTTGCTACTGG - Intergenic
1024781878 7:52860588-52860610 ACAGCTAAGGTGTTTGGTGGGGG - Intergenic
1026152530 7:67800409-67800431 CCTGCTAAGGAGTTCTCTGGTGG - Intergenic
1026690437 7:72546124-72546146 CTTGCAAAGTTGTTTTTTGGGGG - Intergenic
1027406791 7:77871098-77871120 CTTGCTGAGGTGCTTGCTGAAGG - Intronic
1028238141 7:88385075-88385097 CCTGCTGAGGTGCTTGCTGGAGG + Intergenic
1028709316 7:93890144-93890166 CTTGCGACGATGCTTGCTGGAGG - Exonic
1030192486 7:106823575-106823597 CTAGCTGAGGTGCTTGCTGAGGG - Intergenic
1030272123 7:107681044-107681066 CTTGTTATCGTGTCTGCTGGTGG + Intronic
1030559339 7:111065014-111065036 CATGCTGAGGTGCTTGCTGAAGG + Intronic
1030579289 7:111333112-111333134 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
1031074329 7:117198537-117198559 CTTGGTAAGTTCTTTGCTTGTGG + Intronic
1031440950 7:121793941-121793963 CCTGCTGAGGTGTTTGCTGAAGG + Intergenic
1031474186 7:122203419-122203441 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1031861410 7:126983834-126983856 CCTGCTAAGGTGCTTGCTAAAGG + Intronic
1032532717 7:132635560-132635582 ATTGCTAAGAGGTTTCCTGGAGG + Intronic
1035126645 7:156612542-156612564 CTTGTAAAGGGGCTTGCTGGAGG + Intergenic
1035845885 8:2863771-2863793 CTTGCTAAGGTGTTTGAGAAGGG - Intergenic
1036703626 8:11030571-11030593 CTTGCAGAGGTCATTGCTGGTGG - Intronic
1037383393 8:18312172-18312194 CCAGCTAATGTGTTTGCTGAGGG + Intergenic
1037675455 8:21047265-21047287 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1039323921 8:36464612-36464634 CTTGCTGAGATGCTTGCTGAAGG - Intergenic
1039526984 8:38225827-38225849 CTAGCTAAGGTGCTTGCTGAAGG - Intronic
1039857893 8:41432058-41432080 CCAGCTAAGGTGCTTGCTGAGGG + Intergenic
1040912199 8:52530349-52530371 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1041839041 8:62248446-62248468 CTTGCTGAGGGTTGTGCTGGGGG - Intergenic
1044285701 8:90410514-90410536 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1044486901 8:92765244-92765266 CCTGCTAAGGTGTTTGCTGAAGG - Intergenic
1046128380 8:109939436-109939458 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1046197829 8:110886146-110886168 CCTGCTGAGGTGTTTGTTGAAGG + Intergenic
1046417342 8:113935238-113935260 CCTGCTGAGGTGTTTGCTGAAGG - Intergenic
1047748562 8:127863611-127863633 CTTACTTAGGTGTGTGCTTGTGG + Intergenic
1048777977 8:137968440-137968462 CTTGCTAAGGTTTTTTATTGAGG - Intergenic
1049538791 8:143196067-143196089 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1049783437 8:144439355-144439377 CTTGCCAGGTTGGTTGCTGGGGG - Intronic
1050683476 9:8140840-8140862 GATGAGAAGGTGTTTGCTGGAGG + Intergenic
1050864708 9:10483553-10483575 CTTGCTAATTTGTTTCCTTGTGG - Intronic
1050902102 9:10961850-10961872 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1052227852 9:26110316-26110338 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
1052368922 9:27642775-27642797 CCTGCTAAGATGCTTGCTGAAGG + Intergenic
1053695701 9:40637609-40637631 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1053790235 9:41681469-41681491 CTGTCTAAGGTGTGTGGTGGTGG - Intergenic
1053942691 9:43268652-43268674 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1054154907 9:61633286-61633308 CTGTCTAAGGTGTGTGGTGGTGG + Intergenic
1054178581 9:61893170-61893192 CTGTCTAAGGTGTGTGGTGGTGG - Intergenic
1054306948 9:63436827-63436849 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1054474695 9:65564411-65564433 CTGTCTAAGGTGTGTGGTGGTGG + Intergenic
1054658952 9:67687659-67687681 CTGTCTAAGGTGTGTGGTGGTGG + Intergenic
1054728699 9:68678550-68678572 CATGCAATGCTGTTTGCTGGTGG + Intergenic
1055103369 9:72487647-72487669 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1055903668 9:81269254-81269276 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1058259005 9:102807751-102807773 CCTGCTAAGGTGCTTGCTGAAGG - Intergenic
1061361958 9:130149229-130149251 CTTGATAAAGTGGTTGGTGGTGG + Intergenic
1062026913 9:134344733-134344755 GTTGCTAAGGGGTATGGTGGTGG - Intronic
1202778146 9_KI270717v1_random:11221-11243 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1186469483 X:9810196-9810218 CCAGCTAAGGTGCTTGCTGAAGG - Intronic
1187524181 X:20039040-20039062 CCTGCTGAGGTGTTTGCTGAAGG + Intronic
1189972442 X:46431929-46431951 CCAGCTGAGGTGTTTGCTGAGGG + Intergenic
1191769242 X:64738157-64738179 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1191933170 X:66396084-66396106 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1192996439 X:76517541-76517563 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1193053762 X:77127698-77127720 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1193288188 X:79738146-79738168 TCTGCTGAGGTGTTTGCTGAAGG + Intergenic
1193298028 X:79854587-79854609 CCTGCTGAGGTGTTTGCTAAAGG + Intergenic
1193833217 X:86312041-86312063 CCTGCTGAGGTGCTTGCTGAAGG + Intronic
1193841291 X:86411833-86411855 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
1193904722 X:87227760-87227782 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1193914553 X:87350028-87350050 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1193979145 X:88159349-88159371 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1194163694 X:90487745-90487767 CTTGCTGAGGTGCTTCCTGGAGG - Intergenic
1194174891 X:90632764-90632786 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1194277161 X:91899933-91899955 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
1194443789 X:93963024-93963046 CCTGCTGAGGTGTTTGCTGAAGG + Intergenic
1194584377 X:95714985-95715007 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1194848978 X:98850234-98850256 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1194959466 X:100218509-100218531 CTTGCTAAGCTGTTTGATCCTGG - Intergenic
1195782078 X:108477947-108477969 CCTGCTAAGCTGCTTGCTGAAGG - Intronic
1196275891 X:113764607-113764629 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1197074178 X:122335923-122335945 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1197182372 X:123549716-123549738 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1197244784 X:124157047-124157069 CCTGCTGAGGTGTTTGCTGAAGG - Intronic
1197347061 X:125336723-125336745 CTTGCAAAGCTGTTTTCTGGTGG + Intergenic
1197409081 X:126094506-126094528 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1197477876 X:126945902-126945924 ATTCCTAAGGTGTTTGTTGGTGG + Intergenic
1197592137 X:128421324-128421346 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1198170304 X:134098633-134098655 CTAGCTGAGGTGCTTGCTGAAGG + Intergenic
1198307183 X:135394697-135394719 CCTGCGGAGGTGTTTGCTGAAGG + Intergenic
1198701566 X:139402223-139402245 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1198782788 X:140255873-140255895 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic
1200509958 Y:4065565-4065587 CTTGCTGAGGTGCTTCCTGGAGG - Intergenic
1200521541 Y:4213954-4213976 CCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1200594505 Y:5122032-5122054 CCTGCTGAGGTGCTTGCTGAAGG - Intronic
1200651920 Y:5849684-5849706 CCTGCTAAAGTGTGTGCTGAAGG + Intergenic
1200976813 Y:9220080-9220102 CCTGCTTAGGTGCTTGCTGAAGG + Intergenic
1201223708 Y:11795458-11795480 TTTTCTCATGTGTTTGCTGGCGG + Intergenic
1202134363 Y:21646466-21646488 CCTGCTGAGGTGCTTGCTGAAGG - Intergenic