ID: 1071433544

View in Genome Browser
Species Human (GRCh38)
Location 10:85625614-85625636
Sequence GCTTGCTAAGGTGTTTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071433544_1071433553 22 Left 1071433544 10:85625614-85625636 CCCCAGCAAACACCTTAGCAAGC 0: 1
1: 0
2: 1
3: 9
4: 187
Right 1071433553 10:85625659-85625681 GCTCCCTGGGTTGTTGCAAAAGG No data
1071433544_1071433551 9 Left 1071433544 10:85625614-85625636 CCCCAGCAAACACCTTAGCAAGC 0: 1
1: 0
2: 1
3: 9
4: 187
Right 1071433551 10:85625646-85625668 TCTCAGTCTACCTGCTCCCTGGG No data
1071433544_1071433550 8 Left 1071433544 10:85625614-85625636 CCCCAGCAAACACCTTAGCAAGC 0: 1
1: 0
2: 1
3: 9
4: 187
Right 1071433550 10:85625645-85625667 TTCTCAGTCTACCTGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071433544 Original CRISPR GCTTGCTAAGGTGTTTGCTG GGG (reversed) Intronic
901064680 1:6489188-6489210 GATTTCTAAGGTGTTGGGTGGGG - Intronic
904089534 1:27935099-27935121 GCTTCCTAAGTAGTTTTCTGTGG - Exonic
906325333 1:44842211-44842233 CCTTCCTCAGGTGTGTGCTGGGG - Intronic
909233509 1:73121312-73121334 ACCAGCTAAGGTGCTTGCTGAGG + Intergenic
909699100 1:78500541-78500563 GCTTGCTGAGGCGTCTGTTGAGG + Intronic
911256475 1:95638929-95638951 TCTTGCCATGGTGTTTACTGTGG + Intergenic
915628927 1:157137285-157137307 GCCTGCTAATGTGGATGCTGAGG - Intronic
916658252 1:166897273-166897295 GCTTGGTAATGGGTTGGCTGTGG + Intergenic
917152725 1:171962058-171962080 GTTTGCTAATGTATTTGCTCAGG + Intronic
917265237 1:173214164-173214186 GCTTCATAGGGTGGTTGCTGAGG - Intergenic
920941820 1:210490562-210490584 GTTTGCTAAGGTGTTTGATTTGG - Intronic
922421298 1:225462553-225462575 TCTGGCTAAGGGGTTTGCTGTGG + Intergenic
924056714 1:240131377-240131399 GCATGCGTAGGAGTTTGCTGTGG + Intronic
1063588712 10:7376245-7376267 GCTGTCTATGGTGTCTGCTGGGG + Intronic
1063923092 10:10950898-10950920 GACTGCCAAGGTGTTTTCTGTGG - Intergenic
1069229398 10:65989867-65989889 GCTTGGCATGGTGTTTGTTGGGG - Intronic
1069868160 10:71516920-71516942 GCTTGCTCAGGAGATGGCTGTGG + Intronic
1070463573 10:76694200-76694222 GCTTGCTAAGGTGGAAGCTTTGG - Intergenic
1070573558 10:77660098-77660120 TCTTGCTGAGGGGTTTGCAGAGG + Intergenic
1071433544 10:85625614-85625636 GCTTGCTAAGGTGTTTGCTGGGG - Intronic
1072687065 10:97543851-97543873 ATTTGCTGTGGTGTTTGCTGTGG + Intronic
1072984701 10:100129531-100129553 GCTTGCCATGGTGCTTGCTGGGG - Intergenic
1075399572 10:122151337-122151359 GCATGGCTAGGTGTTTGCTGAGG + Intronic
1075752924 10:124788538-124788560 TCTTGCTATGCTGTGTGCTGTGG - Intronic
1076459585 10:130632378-130632400 GCTTGATGTGATGTTTGCTGTGG + Intergenic
1077978839 11:7278177-7278199 GCATGCTAATGTGTTAGCTCAGG + Intronic
1078377163 11:10805948-10805970 GTTTGCGGAGTTGTTTGCTGCGG + Exonic
1078799118 11:14624908-14624930 ACTTGCCAAGGTGATAGCTGAGG + Intronic
1079296550 11:19240519-19240541 GCTTCCTAAAGTATTCGCTGGGG - Intronic
1081366769 11:42244572-42244594 GATTCCCAAGGTGTGTGCTGAGG - Intergenic
1081871310 11:46383834-46383856 CCTTCCCAAGGAGTTTGCTGTGG + Intronic
1082810854 11:57478007-57478029 GTTTGCTAAGGTGTTTGCTCTGG - Intergenic
1082976212 11:59075864-59075886 TCTTGGTAGGGTGTCTGCTGTGG + Intergenic
1085659340 11:78349228-78349250 GCTTGCTAACTTGTTTCCAGTGG - Intronic
1086581775 11:88408258-88408280 GCTTGATAAAGTGGTTGTTGAGG + Intergenic
1087992263 11:104758886-104758908 GCTTGCTTAGGTGTTGACAGTGG - Intergenic
1088938983 11:114434806-114434828 TCCTGCTAAGCTCTTTGCTGAGG + Intronic
1089377604 11:118005636-118005658 ACTTACTAAGGAGTTTGATGGGG - Intergenic
1090320132 11:125835914-125835936 GCTTGCTTAGGTGTTTGTAATGG - Intronic
1091801331 12:3326490-3326512 GTTTGTTAGGGTGTTTGCTTTGG + Intergenic
1093645981 12:21585585-21585607 ACCTGCTGAGGTGCTTGCTGAGG + Intronic
1096218146 12:49809662-49809684 GCTGGAAAGGGTGTTTGCTGTGG - Intronic
1104081373 12:125433273-125433295 GCTTGTAAAGGTATTGGCTGTGG + Intronic
1105473571 13:20712747-20712769 GCTGGCGAAGGTGTCTGCAGCGG + Intronic
1105795245 13:23845264-23845286 GCTTTGTCATGTGTTTGCTGTGG - Intronic
1107580984 13:41785399-41785421 GCTTGCTAAGGTATTTCCACAGG - Intronic
1107815568 13:44241713-44241735 GGCAGCTCAGGTGTTTGCTGGGG - Intergenic
1108230255 13:48331489-48331511 GCATGCTAAGATGTTAGCTTGGG - Intronic
1108896741 13:55338490-55338512 GATTGCTATGATGTTAGCTGTGG + Intergenic
1112206977 13:97334115-97334137 GCATGCTCATGTGTTTGTTGGGG - Intronic
1112787270 13:102964907-102964929 CCTTACTCAGGTGTTTACTGTGG + Intergenic
1115773067 14:36686790-36686812 ACTGGCTGATGTGTTTGCTGAGG + Intronic
1121190154 14:92020520-92020542 GCTTGCTTAGATGTTGTCTGAGG - Intronic
1123913211 15:24991364-24991386 GCTTGTTAATGTAGTTGCTGTGG + Intergenic
1127483052 15:59394909-59394931 GATTGAGAAGGTTTTTGCTGAGG - Intronic
1130042202 15:80414315-80414337 GCTGGATAAGCTCTTTGCTGTGG - Intronic
1131720536 15:95163627-95163649 GCTTGCTAAGGTAGTTTCAGAGG + Intergenic
1134415864 16:14042933-14042955 TTTTGCTAAGTTGTTTGCTCCGG + Intergenic
1135880492 16:26250865-26250887 GATTGCAAACATGTTTGCTGAGG + Intergenic
1139158217 16:64470452-64470474 GCTTCCACAGCTGTTTGCTGTGG + Intergenic
1139599359 16:67977273-67977295 GCTTGCTAACGTGTCCACTGTGG - Exonic
1139647162 16:68339782-68339804 GCTTGCTGAAGTCTATGCTGAGG - Exonic
1140894347 16:79311881-79311903 GATTGCTAAGGGCTCTGCTGAGG - Intergenic
1141094266 16:81151795-81151817 CCTCGATAAGGTGTTTCCTGTGG - Intergenic
1143432421 17:6896700-6896722 GATTGCTGAGGTTATTGCTGTGG + Intronic
1145834975 17:27947944-27947966 GCTTGATAAGGGGTTTGCATTGG + Intergenic
1147532866 17:41296298-41296320 GGTTGGTGAGGTGTTGGCTGGGG - Intergenic
1148017153 17:44529994-44530016 GCTGACTCAGGTGTGTGCTGAGG - Intergenic
1149468986 17:56901096-56901118 GCTTGTTATTGTGTTTGGTGGGG - Intronic
1150699220 17:67433288-67433310 GATTGCTAAGGTCTTAGCCGCGG + Intronic
1151879865 17:76888507-76888529 GCTGGCTAGGGTGCTTGCTGGGG - Intronic
1155120966 18:22818030-22818052 CCTTGCTAATGTGTTTGTTTTGG - Intronic
1158878152 18:61752348-61752370 GCTTTCTAGTGTTTTTGCTGTGG - Intergenic
1158895637 18:61910211-61910233 GGTTGCTTAGGTGTCAGCTGAGG + Intergenic
1159525302 18:69581258-69581280 GGTTGATAACTTGTTTGCTGTGG + Intronic
1160092713 18:75841953-75841975 ACCTGCTGAGGTGCTTGCTGAGG + Intergenic
1164709001 19:30341017-30341039 GCTTGCTAAAGAGATTGCTGGGG - Intronic
1166637304 19:44461667-44461689 GCTTACAATGGTGTTGGCTGGGG - Intergenic
935430036 2:102966066-102966088 GCAAGCAAAGGTGTTGGCTGGGG + Intergenic
936111974 2:109672037-109672059 GCTTGTTAAGGTCATTGCTTGGG - Intergenic
938543607 2:132306734-132306756 GCTTACGATGGTGTTGGCTGGGG - Intergenic
941652537 2:168108094-168108116 GCTTTCTAAAATGTTTTCTGGGG + Intronic
941668297 2:168263030-168263052 ACCTGCTGAGGTGCTTGCTGAGG + Intergenic
942423583 2:175835239-175835261 CCTTGTTAAAGTGTTTGCTTTGG + Intergenic
944444971 2:199780159-199780181 GCTGGATAAGGTCTTTGCTGTGG - Intronic
946449416 2:219766885-219766907 GCATGCTGAGGTGGTGGCTGTGG + Intergenic
946813191 2:223549002-223549024 GCTTTCTAAGGTGCATTCTGAGG + Intergenic
947848471 2:233264575-233264597 GCTTGCTCAGGCTTTTGCTCAGG + Intronic
1170006328 20:11673438-11673460 ACTAGCTGAGGTGCTTGCTGAGG + Intergenic
1170169336 20:13393572-13393594 GCTTGACAAGGTGGTTGTTGAGG - Intronic
1170383472 20:15788209-15788231 GTTTTCTAAGGTGTTTTCTAAGG - Intronic
1171872472 20:30539440-30539462 GCTTACGATGGTGTTGGCTGGGG - Intergenic
1172298945 20:33834545-33834567 GCTTGTTAAGGTGGAAGCTGAGG + Intronic
1172695076 20:36816868-36816890 GCTTGCTAAGTTCCTGGCTGGGG + Intronic
1174402993 20:50285910-50285932 GCCTGCTAAGGAGGATGCTGGGG - Intergenic
1174970775 20:55273272-55273294 GTCAGCTAAGGTCTTTGCTGAGG - Intergenic
1176998404 21:15581948-15581970 GGGTGTTACGGTGTTTGCTGGGG + Intergenic
1183436021 22:37795725-37795747 CCTTGCTAAAGGGTTGGCTGTGG - Intergenic
1184621774 22:45684577-45684599 ACTTGTTTAGGTGTTTCCTGTGG + Intronic
1185355189 22:50364728-50364750 GTGTGCAAAGGTGTTAGCTGGGG + Intronic
953722273 3:45366813-45366835 GCTTGCTATGGTATTTCCCGGGG + Intergenic
953867466 3:46596632-46596654 GCCTGGTAAGGGGCTTGCTGAGG + Intronic
954639238 3:52088295-52088317 GCTCGCTAAGATGATTGCTCAGG - Intronic
955234066 3:57124180-57124202 CATTGCTAAGGTGGTTTCTGAGG - Intronic
956047898 3:65215769-65215791 ACAAGCTGAGGTGTTTGCTGAGG + Intergenic
957660138 3:83139410-83139432 CCTTGCTTAAGTGTTTGTTGTGG - Intergenic
958779259 3:98522364-98522386 CCTTTGTAAGGTGTTTGGTGCGG - Exonic
959227521 3:103604012-103604034 GTTTGCTCAGGTGTTGGCAGTGG - Intergenic
959235950 3:103721926-103721948 GCTTGCTATGGTGATGGCTCTGG + Intergenic
960258893 3:115542540-115542562 CCTTGCAAAGGTCTTTGCTCAGG - Intergenic
962700272 3:137991466-137991488 GCTTGCTAATAAGTTTGTTGAGG - Intergenic
966421284 3:179736866-179736888 GCTTGCTATGGTCTGTGTTGGGG + Intronic
966467499 3:180247282-180247304 GCTTGTTAAGGTGTTATCTTTGG + Intergenic
967118763 3:186364286-186364308 GATTGGTAAGTAGTTTGCTGTGG + Intergenic
967846126 3:194044670-194044692 TCTTGCTAAGCTGGATGCTGTGG + Intergenic
968498932 4:936037-936059 GTTTCATAAGGTGATTGCTGAGG - Intronic
970757493 4:19443703-19443725 GCTTGCTCAGGTGCTGGCAGTGG - Intergenic
970891158 4:21046012-21046034 GGTTGGCAAGGTGTTTGATGAGG + Intronic
972690612 4:41394217-41394239 GATTGTTGAGGTGGTTGCTGTGG + Intronic
974817269 4:67021507-67021529 ACATGCTAAGGTGCTTGGTGTGG - Intergenic
976033948 4:80793906-80793928 ACTTTCTGAGGTGCTTGCTGAGG - Intronic
982787503 4:159553095-159553117 GCTTGGTAAGCTGTGTGCTCTGG + Intergenic
983703742 4:170631680-170631702 GCTTACTATGGTGTTGGCTTTGG + Intergenic
988901785 5:35740752-35740774 GCTTGTTATTGTGCTTGCTGGGG - Intronic
989345368 5:40423501-40423523 ACTTGATAAGGTGATTTCTGAGG + Intergenic
989619202 5:43367994-43368016 GCTTGCTAGGGTATGTGATGGGG + Intergenic
991234386 5:64377018-64377040 CCCAGCTAAGGTGATTGCTGAGG + Intergenic
992515228 5:77484967-77484989 CCTTGCTTAGTTATTTGCTGAGG - Intronic
993782471 5:92084803-92084825 GCATGGAAAGGTGATTGCTGGGG - Intergenic
994123697 5:96146659-96146681 GTATGTTAATGTGTTTGCTGTGG - Intergenic
995438204 5:112160885-112160907 GCTTGCTGTGGTTTTTGCTCTGG + Intronic
997441171 5:133909560-133909582 GCATGCTCAGGAGTTTGCTTAGG + Intergenic
998209956 5:140188229-140188251 GCTTGCTAATTTTTTTGCGGGGG + Intronic
998668442 5:144325742-144325764 GCTTGATGAGGGCTTTGCTGGGG - Intronic
1002264054 5:178018171-178018193 GCCTGCAAAGGTGTTCGCAGTGG + Intronic
1003202606 6:3976071-3976093 ACTGGCTGAGGTGCTTGCTGGGG - Intergenic
1003354836 6:5358226-5358248 GCTTGCTAAATTGTTTGTGGGGG + Intronic
1004359159 6:14955681-14955703 GCGTTCTGAGGTGTTTCCTGAGG + Intergenic
1006337323 6:33427603-33427625 CAATGCCAAGGTGTTTGCTGAGG + Intronic
1008008543 6:46438388-46438410 GCTTGGTGAGGTGTCTGCAGTGG - Intronic
1009267902 6:61579378-61579400 CCTTTCTAAGGAGTTTGCTTTGG - Intergenic
1009290489 6:61875068-61875090 GCTTTTTAAGGTGTTAGCTAAGG + Intronic
1010198089 6:73259737-73259759 GCTTGACAAGGTTTTTGCTATGG + Intronic
1012421621 6:99072011-99072033 ACTTGCCAAGGTGATAGCTGAGG + Intergenic
1012977986 6:105800406-105800428 TCTTGCTTAGGTGCTGGCTGGGG - Intergenic
1014850697 6:126336727-126336749 GCATGCTAATGTGTTAGCTCAGG + Intergenic
1018653811 6:166012777-166012799 CCTTGCTAAAATGTTTGCTATGG - Intergenic
1020199862 7:6071284-6071306 GCCAGCTGAGGTGTTTGTTGAGG - Intergenic
1020351788 7:7227751-7227773 GCATGCTAACGTGTTAGCTTAGG - Intronic
1021634509 7:22678511-22678533 TCTAGCTGAGCTGTTTGCTGGGG + Intergenic
1023295273 7:38708279-38708301 GTCTGCTAGGGTCTTTGCTGGGG + Intergenic
1023508727 7:40927417-40927439 GCTTGCTGAGGTCTTTCCTGTGG + Intergenic
1024140284 7:46456052-46456074 GCATGCCAAGGTGTGTGGTGTGG + Intergenic
1025028749 7:55538750-55538772 GCTTTCTAAGGGGAATGCTGTGG + Intronic
1030050437 7:105532456-105532478 GCTTGTGAAGGTGCTTCCTGCGG + Intronic
1030192487 7:106823576-106823598 ACTAGCTGAGGTGCTTGCTGAGG - Intergenic
1030495339 7:110291663-110291685 GCTTGAACAGGTATTTGCTGCGG - Intergenic
1031707304 7:124996881-124996903 ACATGCTAATGTGTTTGCTCAGG + Intergenic
1031750897 7:125572592-125572614 GATTGACAAGGTGCTTGCTGTGG - Intergenic
1032010102 7:128340377-128340399 GCATGCTAATGTGCTTGCTCAGG - Intronic
1033754005 7:144382980-144383002 GCTTTCTAAGCTGTGTGCTTAGG - Intergenic
1035845886 8:2863772-2863794 ACTTGCTAAGGTGTTTGAGAAGG - Intergenic
1037001495 8:13724555-13724577 GCATGCTAAGGGGTTGCCTGTGG + Intergenic
1037383391 8:18312171-18312193 ACCAGCTAATGTGTTTGCTGAGG + Intergenic
1037868903 8:22472732-22472754 ACTTCCTAAGGAGTTTGTTGAGG + Intronic
1038762700 8:30399474-30399496 GCTGGCTCATGTGTTTGATGGGG + Intronic
1038952964 8:32435670-32435692 GCCTGGTAACGTTTTTGCTGTGG - Intronic
1039857891 8:41432057-41432079 ACCAGCTAAGGTGCTTGCTGAGG + Intergenic
1040349691 8:46551682-46551704 GCTTGTTCAGGTGTCAGCTGTGG - Intergenic
1040368694 8:46746848-46746870 GCTTGTTCAGGTGTCAGCTGTGG + Intergenic
1040726092 8:50383611-50383633 ACCAGCTGAGGTGTTTGCTGAGG - Intronic
1042023966 8:64402905-64402927 GCTTTTGAATGTGTTTGCTGTGG + Intergenic
1042564682 8:70100143-70100165 GCCTCCTGAGGTGATTGCTGAGG - Intergenic
1042939884 8:74096868-74096890 ACTTCCTAAAGTGTTTGTTGGGG + Intergenic
1046545364 8:115642741-115642763 ACTTACTAATGTTTTTGCTGGGG - Intronic
1050544908 9:6701503-6701525 GCTAACTAAGGTGTTCACTGTGG + Intergenic
1051328989 9:16003858-16003880 CTTTGCTAAAATGTTTGCTGTGG + Intronic
1052174116 9:25435525-25435547 TTTTGCTAAGGTTTTTGATGTGG - Intergenic
1052610226 9:30762080-30762102 GCATGCTGAGGTCTTTGCTGTGG + Intergenic
1053577577 9:39368681-39368703 GGTTGCTCAGAGGTTTGCTGTGG + Intergenic
1053842082 9:42196633-42196655 GGTTGCTCAGAGGTTTGCTGTGG + Intergenic
1054099152 9:60927398-60927420 GGTTGCTCAGAGGTTTGCTGTGG + Intergenic
1054120551 9:61203022-61203044 GGTTGCTCAGAGGTTTGCTGTGG + Intergenic
1054587199 9:66979534-66979556 GGTTGCTCAGAGGTTTGCTGTGG - Intergenic
1054716361 9:68560824-68560846 GCTTGCTGAGCTGTGTGCTGTGG - Intergenic
1056940565 9:90952424-90952446 GCTTGCTTGTGTGTTTGCTTTGG - Intergenic
1057914883 9:99047911-99047933 GTTTACTGAGGTGTCTGCTGTGG + Intronic
1059541128 9:115131599-115131621 TTTTGCTAAGGAGTTTACTGAGG + Intergenic
1059746901 9:117211094-117211116 GTTTGGTAAGATGTTAGCTGTGG - Intronic
1060804888 9:126569043-126569065 GCGAGCTATGGTGTTGGCTGGGG - Intergenic
1189015282 X:37090713-37090735 GCTGGCTCATGTGTTTGATGGGG + Intergenic
1189284061 X:39839495-39839517 GCTTAATCAGGTGTGTGCTGCGG - Intergenic
1189919883 X:45893127-45893149 GTTTGAGAAGGTGGTTGCTGAGG - Intergenic
1189972440 X:46431928-46431950 ACCAGCTGAGGTGTTTGCTGAGG + Intergenic
1190528661 X:51353111-51353133 GCTAGCTTTGGTGTTTACTGTGG - Intergenic
1191049398 X:56175138-56175160 GCTTTTGAATGTGTTTGCTGTGG + Intergenic
1200213508 X:154357233-154357255 GCTAGGTAAGCTGCTTGCTGGGG - Exonic
1202012366 Y:20357643-20357665 GTTTTCTAAGGTGTATGTTGTGG + Intergenic