ID: 1071433545

View in Genome Browser
Species Human (GRCh38)
Location 10:85625615-85625637
Sequence TGCTTGCTAAGGTGTTTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071433545_1071433550 7 Left 1071433545 10:85625615-85625637 CCCAGCAAACACCTTAGCAAGCA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1071433550 10:85625645-85625667 TTCTCAGTCTACCTGCTCCCTGG No data
1071433545_1071433551 8 Left 1071433545 10:85625615-85625637 CCCAGCAAACACCTTAGCAAGCA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1071433551 10:85625646-85625668 TCTCAGTCTACCTGCTCCCTGGG No data
1071433545_1071433553 21 Left 1071433545 10:85625615-85625637 CCCAGCAAACACCTTAGCAAGCA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1071433553 10:85625659-85625681 GCTCCCTGGGTTGTTGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071433545 Original CRISPR TGCTTGCTAAGGTGTTTGCT GGG (reversed) Intronic
905251998 1:36655317-36655339 TGCTTGCTAGGGTTGTTGCGGGG + Intergenic
909357811 1:74729323-74729345 TGTTTGCTAAGTTCTGTGCTTGG - Intronic
911444001 1:97968344-97968366 TAGTTGGTTAGGTGTTTGCTAGG + Intergenic
912758940 1:112348763-112348785 TGTTTCTTAAGGTGGTTGCTGGG - Intergenic
913354026 1:117898396-117898418 TGCTTCCTAAGATTTTGGCTTGG + Intronic
914875303 1:151509218-151509240 TAATTGCTAAGGTGTTATCTAGG + Intergenic
917655978 1:177126102-177126124 TGCTTCCTCAGGTGCTTTCTTGG + Intronic
917674290 1:177304669-177304691 TGCTTGCTCAGGTGTGATCTTGG - Intergenic
917704812 1:177621607-177621629 AGATTGTTCAGGTGTTTGCTTGG + Intergenic
920660212 1:207909059-207909081 AGCTTTCTAGGGTTTTTGCTTGG - Intronic
923457829 1:234180282-234180304 TGCATGCCATGGTGTTTCCTTGG + Intronic
1063588711 10:7376244-7376266 TGCTGTCTATGGTGTCTGCTGGG + Intronic
1070283201 10:75065206-75065228 TGCTTGCTAAGGTGGCAGATGGG + Intergenic
1071433545 10:85625615-85625637 TGCTTGCTAAGGTGTTTGCTGGG - Intronic
1072984702 10:100129532-100129554 GGCTTGCCATGGTGCTTGCTGGG - Intergenic
1075236896 10:120738796-120738818 TGATGGCTAATGAGTTTGCTGGG - Intergenic
1075575319 10:123573296-123573318 GGGTTGCTAAGCTGTTTGGTCGG + Intergenic
1077185452 11:1233643-1233665 TGCCTGCTGCTGTGTTTGCTGGG - Intronic
1079296551 11:19240520-19240542 TGCTTCCTAAAGTATTCGCTGGG - Intronic
1079371467 11:19856808-19856830 TGCATTCAAAGGTATTTGCTTGG + Intronic
1087909616 11:103738035-103738057 TGCATGCCAAGGTTTCTGCTGGG - Intergenic
1089075015 11:115731317-115731339 TGATTGATAATGTGATTGCTAGG + Intergenic
1089887499 11:121842091-121842113 TGCTTGCTTAGCTTTTTGATTGG - Intergenic
1090059203 11:123449287-123449309 TGCCTGCTAAGCTCTTTGCATGG + Intergenic
1091111571 11:132973873-132973895 TGCTTGGTAAGGGGTAGGCTAGG - Intronic
1091111580 11:132973921-132973943 TGCTTGGTAAGGGGTAGGCTAGG - Intronic
1094089455 12:26631936-26631958 TGCTTGCTCGGGTGGATGCTGGG + Exonic
1095355969 12:41275578-41275600 TGCATGCTAGGGTCTGTGCTAGG + Intronic
1101062629 12:100987889-100987911 TGCTTGCTCATGTGTGTGTTGGG + Intronic
1103544424 12:121689797-121689819 GGCTTGGTAATGTGTTAGCTTGG + Intergenic
1105637728 13:22231564-22231586 TTATTGCTATGGTGTTTTCTTGG - Intergenic
1108230256 13:48331490-48331512 AGCATGCTAAGATGTTAGCTTGG - Intronic
1108853772 13:54768159-54768181 TGCTTGCTATTGTATGTGCTCGG + Intergenic
1114938029 14:27569493-27569515 TGTTTGCTAAGATGTATGCTTGG - Intergenic
1115823841 14:37241948-37241970 TGCTTGCTGGCGTGTTTGCTTGG - Intronic
1116050178 14:39793069-39793091 TGATTTCTAAACTGTTTGCTGGG - Intergenic
1116752602 14:48905489-48905511 TGGTTTCTCAGGTGGTTGCTTGG + Intergenic
1116862713 14:50007445-50007467 TGCTTCCTAAGGTGATGGCGAGG + Exonic
1120332881 14:83115967-83115989 TTCTTTCTAAGGTGTCTGCTTGG + Intergenic
1122065190 14:99168211-99168233 TGCTTGCTAAGGTGATTTGTGGG - Intergenic
1129412534 15:75358078-75358100 TGCTTCCTAACGTGTGTGCCAGG - Intronic
1130703121 15:86205748-86205770 TTCTTGATAAGGTGTCTGTTAGG + Intronic
1130773399 15:86948256-86948278 TGTTTGCTTTGGTGTTTTCTAGG - Intronic
1130879972 15:88046555-88046577 TACAGGCTAATGTGTTTGCTGGG - Intronic
1132084982 15:98901165-98901187 TGCGTGCTCAGGTGTTTGGGAGG + Intronic
1137489867 16:48923483-48923505 TGATTTCTAAGGTGTTGGATTGG - Intergenic
1139731887 16:68952852-68952874 TGATTGCTAAGGTGTTTCTTAGG + Intronic
1141194073 16:81846398-81846420 TTCTTGCTCAAGTGTTTACTGGG - Intronic
1142330971 16:89453514-89453536 TGCCTGCTAAGGTGTCCCCTAGG + Intronic
1145305325 17:21671028-21671050 TGCTTGCTCAGGTGGGTGGTAGG + Intergenic
1147532867 17:41296299-41296321 TGGTTGGTGAGGTGTTGGCTGGG - Intergenic
1149294857 17:55252882-55252904 TGCTTGCTGAGTTGGTTGGTAGG - Intergenic
1149496078 17:57118444-57118466 TGCTTGCTCAGGTGTGTGGTTGG + Exonic
1151879866 17:76888508-76888530 CGCTGGCTAGGGTGCTTGCTGGG - Intronic
1154250304 18:12738526-12738548 TGAGTCCTAAGGTGTTTACTGGG + Intergenic
1154354577 18:13615213-13615235 TTCCTGCCAAGGTGTTTACTTGG + Intronic
1154402154 18:14050379-14050401 TGTTTGCTAATTTGTTTGTTTGG + Intergenic
1155867189 18:30980711-30980733 TTCTTGATTGGGTGTTTGCTTGG - Intergenic
1157011714 18:43657253-43657275 GGCTTGATAAGATGATTGCTTGG - Intergenic
1159636760 18:70813805-70813827 TGCTTGCAACATTGTTTGCTTGG + Intergenic
1162565078 19:11441486-11441508 TGCTTTCTCAGTTGTGTGCTAGG + Intronic
1164709002 19:30341018-30341040 GGCTTGCTAAAGAGATTGCTGGG - Intronic
1165896139 19:39142347-39142369 CGCTTTCTTAGGTGGTTGCTTGG + Intronic
1166954723 19:46455698-46455720 TGCTTGGTGGGGTGTTTGGTTGG - Intergenic
925793722 2:7520480-7520502 TGCTTGCTAATGTGTTGGAGAGG + Intergenic
927967898 2:27283051-27283073 TGCTTGCTCTGGGATTTGCTTGG - Intronic
929324535 2:40592416-40592438 TGCTTGCTAAGTTCTCTGCAAGG + Intronic
931721494 2:65070463-65070485 TGCTTGCCAAGGCCTTTCCTGGG + Intronic
935430035 2:102966065-102966087 TGCAAGCAAAGGTGTTGGCTGGG + Intergenic
935837833 2:107074775-107074797 TGCTTCTTTAGGTGTTTCCTTGG + Intergenic
936111975 2:109672038-109672060 TGCTTGTTAAGGTCATTGCTTGG - Intergenic
938139697 2:128785391-128785413 TTCATGCTAAGGTGTATTCTTGG + Intergenic
938218263 2:129542265-129542287 TTCTTGATTGGGTGTTTGCTTGG - Intergenic
940339296 2:152562935-152562957 TCCTTACTAAGGTGGTAGCTTGG - Intronic
942187550 2:173438633-173438655 TGCTTTCTAAAGGGATTGCTGGG - Intergenic
943234755 2:185302752-185302774 TGCTTGCTAATGATTTTACTTGG + Intergenic
945577130 2:211545681-211545703 TTCATGCTAATGTGCTTGCTTGG + Intronic
946943476 2:224794950-224794972 TGCTTGCGTAGGAGTTTGCCAGG + Exonic
947631341 2:231655342-231655364 TGTTTGCTAATGTATTTTCTTGG - Intergenic
1169548195 20:6672636-6672658 TGTTTTCTAAGGTTATTGCTGGG - Intergenic
1171162209 20:22937709-22937731 TCATTGGTTAGGTGTTTGCTTGG + Intergenic
1171530583 20:25850469-25850491 TGCTTGCTCAGGTGGGTGGTAGG + Intronic
1172695075 20:36816867-36816889 TGCTTGCTAAGTTCCTGGCTGGG + Intronic
1177611921 21:23460769-23460791 TGCTTTCTATGGTGGTGGCTTGG + Intergenic
1178509403 21:33191202-33191224 TGGTTGCTTGGTTGTTTGCTTGG + Intergenic
1178509421 21:33191386-33191408 TGCTTGCTTCGTTGCTTGCTTGG + Intergenic
1178509423 21:33191398-33191420 TGCTTGCTTGGTTGGTTGCTTGG + Intergenic
1178509447 21:33191550-33191572 TGCTTGCTTTGTTGCTTGCTTGG + Intergenic
1179112967 21:38463202-38463224 TGCTTGCTGGGGTCTGTGCTTGG + Intronic
1183315154 22:37132997-37133019 TGCTTGCTAAGCTGAGTGCCTGG + Intronic
1183975705 22:41510886-41510908 TTCTTGGTAATGTGTTTGATGGG - Intronic
1185355188 22:50364727-50364749 TGTGTGCAAAGGTGTTAGCTGGG + Intronic
949505251 3:4721528-4721550 GGCTTGCAAATATGTTTGCTGGG - Intronic
953529670 3:43728977-43728999 TGGTTTCTAACATGTTTGCTGGG + Intronic
957667531 3:83252033-83252055 TGTTTAATAAGGTGTTTTCTTGG - Intergenic
962949538 3:140205179-140205201 AGCATCCAAAGGTGTTTGCTGGG + Intronic
966421283 3:179736865-179736887 TGCTTGCTATGGTCTGTGTTGGG + Intronic
971682655 4:29721039-29721061 TTGTTGCTAAACTGTTTGCTAGG + Intergenic
973714419 4:53661050-53661072 TGCTAGATACGGTGTTGGCTAGG - Intronic
977737143 4:100430596-100430618 TGCTTCCTAAAGTGATTGCTGGG + Intronic
978462252 4:108969139-108969161 TGTCTACTCAGGTGTTTGCTTGG + Intronic
983832030 4:172339477-172339499 TGCTTGCTCTGGAGTTTGGTAGG - Intronic
988119435 5:26941954-26941976 TGCATGCTAAGGTGCTAGCTAGG + Intronic
988901786 5:35740753-35740775 TGCTTGTTATTGTGCTTGCTGGG - Intronic
989619201 5:43367993-43368015 TGCTTGCTAGGGTATGTGATGGG + Intergenic
993198013 5:84775314-84775336 TGCCTGCTAAAGTTTTTGGTAGG - Intergenic
996479443 5:123957807-123957829 AGCTTGCTAGTGTGTTTACTGGG - Intergenic
1000055550 5:157602928-157602950 TGCTTGTAAAAGTGTTTGCCAGG - Intergenic
1001122345 5:168991242-168991264 TGCTTGATAAGGTTTTTGGAAGG - Intronic
1003354835 6:5358225-5358247 TGCTTGCTAAATTGTTTGTGGGG + Intronic
1004737431 6:18421725-18421747 TGCGTGCAAAGGTGTATTCTTGG - Intronic
1005205697 6:23401928-23401950 TGCTTCCTAATGTGTTCCCTTGG - Intergenic
1006644938 6:35509524-35509546 TGCTAGGTAAGGAGTTTGCCAGG - Intronic
1011060253 6:83257615-83257637 AGCTAGCTAAAGTGTTTCCTTGG - Intronic
1013792852 6:113856073-113856095 TGCTTATTAAGCTGTTTCCTTGG + Intergenic
1015495333 6:133875860-133875882 TGGTGGCTAAGGTGTTTGTGTGG - Intergenic
1015802905 6:137078564-137078586 TGCTGGCTCAGGTGTTTGAGAGG - Intergenic
1016313312 6:142758214-142758236 AGCTTGCTAATTTGTTAGCTTGG + Intronic
1017835585 6:158174623-158174645 TGCTTGCTTTGGTAATTGCTTGG - Intronic
1019199830 6:170305738-170305760 TGCCTGCCAAAATGTTTGCTTGG + Intronic
1020736668 7:11957881-11957903 TGCTTCCTTAGGTGGCTGCTTGG - Intergenic
1021606451 7:22413839-22413861 TGCTTGCTCAGATGTTTCTTTGG + Intergenic
1023295272 7:38708278-38708300 TGTCTGCTAGGGTCTTTGCTGGG + Intergenic
1030232931 7:107226801-107226823 TGCTTTCTCAGTTGTTTGATGGG - Intronic
1030952124 7:115803880-115803902 GGCCTGATAAGATGTTTGCTTGG - Intergenic
1031853035 7:126888678-126888700 TGCTAGCTAAGCTGTTGGATGGG - Intronic
1035490971 7:159277962-159277984 TCCTTGATGGGGTGTTTGCTTGG + Intergenic
1035635194 8:1139075-1139097 TGGTTGTTCAGGTGTTTCCTCGG + Intergenic
1035976949 8:4323567-4323589 TGCTTTCCAAGGTGTTTGAGTGG + Intronic
1037763621 8:21758233-21758255 GGCTTGCTAAATTGTGTGCTGGG - Intronic
1038622667 8:29158715-29158737 TGCTTGCTGTGGGGTTAGCTTGG + Intronic
1043214139 8:77564214-77564236 TACTTAGTAAAGTGTTTGCTGGG - Intergenic
1045067647 8:98465155-98465177 TGCCCCCTAAGGTGATTGCTAGG - Intronic
1047121168 8:121907056-121907078 TTCTTCCTAAGGTGTGTACTAGG - Intergenic
1048937400 8:139368471-139368493 TGCTTGCTACTGTATGTGCTAGG - Intergenic
1050035948 9:1436414-1436436 TGCTTTCCAAGGTGTATGCATGG + Intergenic
1053563100 9:39216581-39216603 TGCTTGGCCAGGTGTTTGTTAGG + Intronic
1057456616 9:95218897-95218919 TTCTTGATTGGGTGTTTGCTTGG - Intronic
1057581446 9:96290953-96290975 TTTTTCCCAAGGTGTTTGCTTGG - Intronic
1058626710 9:106941021-106941043 TGCTAGCAAAGGCTTTTGCTGGG + Intronic
1060811900 9:126614879-126614901 AGCTCGCCAAGGTGATTGCTAGG - Intronic
1062539653 9:137035893-137035915 TGCTTCCTAGGATGTTGGCTAGG + Exonic
1187769101 X:22675629-22675651 TGCTTGCTTGTTTGTTTGCTTGG + Intergenic
1195018728 X:100804678-100804700 TTCTTGACTAGGTGTTTGCTTGG - Intergenic
1195629204 X:107036539-107036561 TTCTTGATTCGGTGTTTGCTTGG - Intergenic