ID: 1071433546

View in Genome Browser
Species Human (GRCh38)
Location 10:85625616-85625638
Sequence CTGCTTGCTAAGGTGTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071433546_1071433553 20 Left 1071433546 10:85625616-85625638 CCAGCAAACACCTTAGCAAGCAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1071433553 10:85625659-85625681 GCTCCCTGGGTTGTTGCAAAAGG No data
1071433546_1071433551 7 Left 1071433546 10:85625616-85625638 CCAGCAAACACCTTAGCAAGCAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1071433551 10:85625646-85625668 TCTCAGTCTACCTGCTCCCTGGG No data
1071433546_1071433550 6 Left 1071433546 10:85625616-85625638 CCAGCAAACACCTTAGCAAGCAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1071433550 10:85625645-85625667 TTCTCAGTCTACCTGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071433546 Original CRISPR CTGCTTGCTAAGGTGTTTGC TGG (reversed) Intronic
902809310 1:18879349-18879371 CTGCTTCCACAGGTGTTTGAAGG + Exonic
904685300 1:32255432-32255454 TTGCTTGCCATGGTGTATGCGGG + Intronic
905251997 1:36655316-36655338 CTGCTTGCTAGGGTTGTTGCGGG + Intergenic
908150914 1:61301897-61301919 CTGTTTCCTAAGGTGGTTGTTGG + Intronic
911333730 1:96556006-96556028 CTGCATGCAAGGGTGTTAGCAGG + Intergenic
911854380 1:102858559-102858581 CAGCTTGTTCATGTGTTTGCTGG - Intergenic
912758941 1:112348764-112348786 CTGTTTCTTAAGGTGGTTGCTGG - Intergenic
916321401 1:163508946-163508968 AAGCCTGCTAACGTGTTTGCAGG + Intergenic
918747786 1:188228195-188228217 CTTCTTGGGAAGGTGTTTCCAGG + Intergenic
919124111 1:193376028-193376050 CAACCTGCTGAGGTGTTTGCTGG - Intergenic
921605049 1:217141803-217141825 CTGCCTGGTAAGATGTATGCTGG + Intergenic
923076175 1:230610683-230610705 CTGTTTGCTTATCTGTTTGCAGG - Intergenic
923288937 1:232525852-232525874 CTGCTTGCTCAGGTGTCAGGTGG - Intronic
1063017897 10:2096547-2096569 CTGCTTTCTAGGGTCTATGCTGG - Intergenic
1063120871 10:3105021-3105043 CTGCTTTCTGAGCTGTTTCCAGG + Intronic
1066177483 10:32924056-32924078 CTGCTTGCCAAGCAGTGTGCTGG - Intronic
1069662836 10:70135067-70135089 ATGCTTGCTGAGGGGTTTCCTGG - Intergenic
1071433546 10:85625616-85625638 CTGCTTGCTAAGGTGTTTGCTGG - Intronic
1071731613 10:88253861-88253883 ATCCTTGCTAAGGTGTTAGGTGG + Intergenic
1073714223 10:106084132-106084154 ATGCTTGCAAGGGTATTTGCAGG - Intergenic
1084468971 11:69344094-69344116 CTGCTGCCTCAGGGGTTTGCTGG - Intronic
1084965514 11:72742363-72742385 CTGCTTGCTAGGTTGTTGGAAGG - Intronic
1085325670 11:75604749-75604771 CTGCTTGCTAATTAGTTAGCAGG + Intronic
1087909617 11:103738036-103738058 CTGCATGCCAAGGTTTCTGCTGG - Intergenic
1106023413 13:25935681-25935703 CTCCATGGTAAGGAGTTTGCAGG - Intronic
1106510630 13:30409418-30409440 CTGCTTGTTTATGTGTTTACAGG - Intergenic
1106555495 13:30804826-30804848 CTGCTTGCAAAGGTGCTGGGAGG - Intergenic
1107986328 13:45779667-45779689 CTGCTTGCTAAGGTTGTTATGGG + Exonic
1111068589 13:83132243-83132265 CTACTTGCTAAGTTATTTGGGGG - Intergenic
1115991400 14:39154239-39154261 CTGCTTACTCAGATGTCTGCAGG - Exonic
1119465991 14:74859071-74859093 CAGCCTGCTTAGATGTTTGCTGG - Intronic
1120654409 14:87171663-87171685 CTGCTTGGTCAGGTCTCTGCAGG - Intergenic
1122065191 14:99168212-99168234 ATGCTTGCTAAGGTGATTTGTGG - Intergenic
1124085204 15:26543033-26543055 CTTCCTTTTAAGGTGTTTGCAGG + Intergenic
1125911791 15:43446554-43446576 CTGGTTGCTATGGTGCTTTCTGG + Exonic
1128233200 15:66049595-66049617 CTGCATGTTAACGGGTTTGCTGG + Intronic
1128873633 15:71184015-71184037 CTGCATTCTAAGGTGGCTGCTGG + Intronic
1130174490 15:81554159-81554181 CTTCTTGCCTAGGTGTTTTCTGG + Intergenic
1130879973 15:88046556-88046578 CTACAGGCTAATGTGTTTGCTGG - Intronic
1133169263 16:3970956-3970978 CTGCCTGCAAAGGTGGTGGCTGG + Intronic
1133391325 16:5412652-5412674 GTTCTTGCTAAGGGCTTTGCAGG + Intergenic
1140523261 16:75600406-75600428 TTGCTTGCTCAGGTGTCTGGTGG - Intronic
1140914148 16:79479739-79479761 CTACGTGCTAAGGTCTGTGCTGG + Intergenic
1143922041 17:10337615-10337637 CTGCTTTCTAAGGTGTCACCAGG + Intronic
1147418303 17:40309268-40309290 CTACCTGCTCAGGTGTGTGCTGG - Exonic
1149008145 17:51826935-51826957 CTGTTTGCAAACGTGTGTGCAGG - Intronic
1149363132 17:55914484-55914506 CTGCTGGCTGAAGTGTCTGCGGG + Intergenic
1150669708 17:67182052-67182074 CTGAGTGCTGAGGTGTTAGCAGG - Intronic
1151879867 17:76888509-76888531 CCGCTGGCTAGGGTGCTTGCTGG - Intronic
1154250303 18:12738525-12738547 CTGAGTCCTAAGGTGTTTACTGG + Intergenic
1156300535 18:35832561-35832583 CTGCTTGCTGCGGTGTTTGTAGG - Intergenic
1156390405 18:36645001-36645023 CAGCTTGATCAGGAGTTTGCAGG - Intronic
1157806595 18:50662951-50662973 CTGCTTGCTCAGGGGATTCCGGG - Intronic
1157819699 18:50757209-50757231 CTGCTTTCCAAGGTGAATGCTGG + Intergenic
1159520506 18:69514862-69514884 ATGCTTGCTATGGGCTTTGCAGG + Intronic
1167836639 19:52077654-52077676 GTGCTTGCTCTGCTGTTTGCAGG - Intronic
927896433 2:26785789-26785811 CTGCTTGCCAATCTGGTTGCTGG - Intronic
931721493 2:65070462-65070484 CTGCTTGCCAAGGCCTTTCCTGG + Intronic
934561681 2:95316887-95316909 CAGCTTGCTAAGGTCTTTCTGGG - Intronic
934860056 2:97757265-97757287 ATGCTTGCCAGCGTGTTTGCTGG + Exonic
940723878 2:157312597-157312619 CTGATTTCTAAGGTGTCTTCTGG - Exonic
940843254 2:158609633-158609655 CTGCTTACTCAGGTGTTTTCAGG + Intronic
942187551 2:173438634-173438656 CTGCTTTCTAAAGGGATTGCTGG - Intergenic
944411973 2:199455618-199455640 CTGTGTGCTGAGGTGTTGGCAGG - Intronic
947854475 2:233313890-233313912 CTGTTTGCTAGGGTGTAGGCAGG + Intronic
1169603958 20:7294229-7294251 ATGCTTGCTAAAGTGTTTAGGGG - Intergenic
1172695074 20:36816866-36816888 CTGCTTGCTAAGTTCCTGGCTGG + Intronic
1173127084 20:40347315-40347337 CTGTTTCATAAGGTTTTTGCTGG - Intergenic
1175551518 20:59820932-59820954 CTGCCTGCTCAGATGCTTGCAGG + Intronic
1181984342 22:26789249-26789271 CAGCTTGCTCAGGGGTGTGCTGG - Intergenic
949525152 3:4895961-4895983 CTGCTTGCTCAGCTTTGTGCGGG - Intergenic
953473825 3:43189328-43189350 CTGAATGTTAAGGTGTTTGAAGG - Intergenic
953529669 3:43728976-43728998 CTGGTTTCTAACATGTTTGCTGG + Intronic
957175616 3:76804163-76804185 ATGAATGCTAAGGGGTTTGCTGG + Intronic
957832989 3:85547819-85547841 CTCCATGCTAAGATTTTTGCTGG - Intronic
962949537 3:140205178-140205200 CAGCATCCAAAGGTGTTTGCTGG + Intronic
966421282 3:179736864-179736886 CTGCTTGCTATGGTCTGTGTTGG + Intronic
966731402 3:183154263-183154285 GTGCTTGCTTAGCTGGTTGCTGG + Exonic
968315960 3:197725825-197725847 CTCCATGCTAAGGAGTTTGTTGG - Intronic
970845215 4:20529682-20529704 CTAAGTGCTAAGGTGTTTGTTGG + Intronic
971153818 4:24061660-24061682 CAGCTTGCTGAGGTGTCTCCAGG + Intergenic
975912151 4:79279769-79279791 CTGTTTTCTAAAGTGTTAGCTGG + Intronic
977737142 4:100430595-100430617 TTGCTTCCTAAAGTGATTGCTGG + Intronic
979994659 4:127416050-127416072 CTGCTTGAAAAGGTGTTGGTAGG - Intergenic
980757188 4:137180215-137180237 CTACTGGCTAAAGTTTTTGCAGG - Intergenic
986831190 5:11580450-11580472 CTGCATGCTAAGGTTTCTGCAGG - Intronic
987522393 5:19003941-19003963 CTGTTTCCTAAGGACTTTGCTGG + Intergenic
988901787 5:35740754-35740776 CTGCTTGTTATTGTGCTTGCTGG - Intronic
989619200 5:43367992-43368014 CTGCTTGCTAGGGTATGTGATGG + Intergenic
995033152 5:107502438-107502460 CTGCTTCCTAAAATGATTGCCGG - Intronic
998209954 5:140188227-140188249 CAGCTTGCTAATTTTTTTGCGGG + Intronic
998403968 5:141863232-141863254 CTGCTTGCTGGGGTATTTGGGGG + Exonic
1003354834 6:5358224-5358246 CTGCTTGCTAAATTGTTTGTGGG + Intronic
1007666880 6:43519429-43519451 CTGCTAGCTGAGGTATTGGCAGG + Exonic
1008661985 6:53678016-53678038 CTGGTTGCTGAGGTGGTGGCTGG + Intergenic
1009701024 6:67181279-67181301 CTGCTTGCTAAGCTGTATGGTGG - Intergenic
1012793465 6:103731250-103731272 CTGCTTGATAAGCTTGTTGCAGG - Intergenic
1016820225 6:148340101-148340123 CTCCTTGCTGAGTTATTTGCTGG + Intronic
1018053907 6:160035474-160035496 CTGCTTGCTAGGACGTTCGCAGG - Intronic
1019422766 7:958713-958735 CTGCTTCCAAAGGGGTTTCCGGG - Intronic
1022786670 7:33644906-33644928 TTGATAACTAAGGTGTTTGCTGG + Intergenic
1023295271 7:38708277-38708299 CTGTCTGCTAGGGTCTTTGCTGG + Intergenic
1027586398 7:80063794-80063816 CTGCTTTCTAAGCTGTGTACGGG - Intergenic
1036617610 8:10400639-10400661 CTGGTTGCTGAGGTGGTGGCAGG + Intronic
1039196314 8:35035355-35035377 CTGTTTGCAAAGATGTTGGCAGG - Intergenic
1041530338 8:58858552-58858574 CTGCTTTCTGTGGTCTTTGCAGG + Intronic
1041643553 8:60228626-60228648 CCGCTTCCTCAGCTGTTTGCTGG + Intronic
1042913075 8:73846490-73846512 CTGATTACTAATGTGTTTGGTGG - Intronic
1046748294 8:117899514-117899536 CAGCTTGCTAACGTGTTCACAGG + Intronic
1049585836 8:143432041-143432063 CTGCTTCCTAAGGTGTCTCGGGG + Intergenic
1050335971 9:4590343-4590365 CTGCTTGCTTAGGAGTTTTGTGG - Intronic
1051431960 9:16988471-16988493 CTGTTTACAAAGGTGTTTGCAGG + Intergenic
1058841941 9:108918354-108918376 CTGCTTGCCAAGGAGCATGCAGG - Intronic
1062026914 9:134344736-134344758 CTGGTTGCTAAGGGGTATGGTGG - Intronic
1185999279 X:4989718-4989740 GTGCTTCCTAAAGTGATTGCAGG - Intergenic
1194792034 X:98161850-98161872 CTGGTTGGTAAGGTTTTTGAGGG + Intergenic
1198507202 X:137312635-137312657 CTACTTACAAAGGTGTTTGTTGG + Intergenic