ID: 1071433547

View in Genome Browser
Species Human (GRCh38)
Location 10:85625626-85625648
Sequence AGAAGGGAATCTGCTTGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071433547_1071433551 -3 Left 1071433547 10:85625626-85625648 CCTTAGCAAGCAGATTCCCTTCT 0: 1
1: 0
2: 3
3: 18
4: 180
Right 1071433551 10:85625646-85625668 TCTCAGTCTACCTGCTCCCTGGG No data
1071433547_1071433550 -4 Left 1071433547 10:85625626-85625648 CCTTAGCAAGCAGATTCCCTTCT 0: 1
1: 0
2: 3
3: 18
4: 180
Right 1071433550 10:85625645-85625667 TTCTCAGTCTACCTGCTCCCTGG No data
1071433547_1071433556 26 Left 1071433547 10:85625626-85625648 CCTTAGCAAGCAGATTCCCTTCT 0: 1
1: 0
2: 3
3: 18
4: 180
Right 1071433556 10:85625675-85625697 CAAAAGGAAAAAAATTGACATGG No data
1071433547_1071433553 10 Left 1071433547 10:85625626-85625648 CCTTAGCAAGCAGATTCCCTTCT 0: 1
1: 0
2: 3
3: 18
4: 180
Right 1071433553 10:85625659-85625681 GCTCCCTGGGTTGTTGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071433547 Original CRISPR AGAAGGGAATCTGCTTGCTA AGG (reversed) Intronic
900062236 1:697568-697590 AGAAAGCAACATGCTTGCTAAGG + Intergenic
901283994 1:8061853-8061875 AGTTCGGAATCTGCTTGTTACGG + Intergenic
901843191 1:11966374-11966396 AGAAGGGAAACTGCTTGCCCTGG + Intronic
902821532 1:18946303-18946325 AGCAGGGAAGCTACTTGCAATGG + Intronic
906518283 1:46452416-46452438 AGAAGAGAATCTGTTTCCTTGGG - Intergenic
907606052 1:55818477-55818499 AGAAGGGAATCTGGGGGCTGTGG - Intergenic
908076908 1:60529835-60529857 CGAAGCAAATCTTCTTGCTATGG + Intergenic
908319065 1:62963440-62963462 TGAAAAGAATCTGCTTGCTCTGG + Intergenic
913546108 1:119870884-119870906 AGGAGGGAAGTTCCTTGCTAGGG + Intergenic
914691577 1:150033639-150033661 TGAAGGCAAAATGCTTGCTACGG - Intergenic
916274676 1:162980840-162980862 AGAAGGGAATCCCTTTGCTAAGG - Intergenic
916440578 1:164820768-164820790 TGAAGGAAATCTGCTTACTATGG - Intronic
917806858 1:178621561-178621583 ACAAGGAAATCTACTTGCAAGGG + Intergenic
918211228 1:182352923-182352945 ATATGGGACTCTGCTTGGTAAGG - Intergenic
920281186 1:204844981-204845003 AGAAAGGAATGTGCTTATTAAGG + Intronic
921393909 1:214648212-214648234 TGAAGTGAAACAGCTTGCTATGG - Intronic
921928330 1:220732197-220732219 GGAAGAGAATCTCCTTGCTTGGG - Intergenic
923658776 1:235940839-235940861 AGAAGGAAATCTGTTTGCAAAGG - Intergenic
1062864117 10:835471-835493 AAAACGGAATCTGCCTGCTTTGG - Intronic
1064802007 10:19086973-19086995 AGAAAGGAATGTGCTTATTAGGG + Intronic
1065057135 10:21857589-21857611 AGAAGGAAATCAGCATGTTAGGG + Intronic
1065956756 10:30700292-30700314 CGAAGGGAATCAGCTCGCTCAGG - Intergenic
1068013387 10:51482755-51482777 AGAAGTTAAGCTGCTTGTTAAGG - Intronic
1069987805 10:72296246-72296268 AAAAGGGAATCTACTGGCTCAGG - Intergenic
1070678953 10:78435331-78435353 AGAGGGGAATAGGATTGCTAAGG + Intergenic
1070740586 10:78900581-78900603 AGAAGGGAACCCCCATGCTAAGG + Intergenic
1071102763 10:82058844-82058866 AGAAGATACTCTGCTTGCCATGG + Intronic
1071433547 10:85625626-85625648 AGAAGGGAATCTGCTTGCTAAGG - Intronic
1072091391 10:92131143-92131165 AGAAGGCAATCTGCTCTCTGAGG + Intronic
1074135828 10:110625741-110625763 AGAAGGGAATCTGCTGGTGTGGG - Intergenic
1074400676 10:113139048-113139070 AGAAGGGAAGATGATTACTAAGG - Intronic
1075470391 10:122684504-122684526 AGAAAGGAATTTGGTTTCTAGGG - Intergenic
1075481270 10:122783986-122784008 AGTAGGGGTTCTGCTTGCTGGGG - Intergenic
1076550372 10:131273976-131273998 AGAAATGAAACTGCTTGCTCAGG + Intronic
1080588216 11:33700091-33700113 ATAAGGGAGTCTGGGTGCTAGGG + Intronic
1081659539 11:44879590-44879612 AGGCGGGAATGTGCTTGCCATGG + Intronic
1081845812 11:46239410-46239432 GGAAGGGAAGCTTCTTGCTTCGG - Intergenic
1082728956 11:56771961-56771983 ATATGGACATCTGCTTGCTAAGG + Intergenic
1083835091 11:65261459-65261481 AGTAGGGAATCTGGTTGCCATGG - Intergenic
1085321957 11:75580446-75580468 AGGAGGAAAACTGCTTGCTAAGG - Intergenic
1086175926 11:83890847-83890869 AGAATGGAATCTGCAGGATATGG + Intronic
1086831667 11:91573398-91573420 AGCAGGGAATCTACTTGGTTAGG - Intergenic
1089955958 11:122571463-122571485 AAAAGGGAAGCTGCTGGGTATGG - Intergenic
1090135189 11:124190568-124190590 AGAAAGGAATGTGCTTATTAGGG - Intergenic
1090956694 11:131519363-131519385 AGAGGTGAACCTGCTTGTTAGGG + Intronic
1090956707 11:131519481-131519503 AGAGGTGAACCTGCTTGTTAGGG + Intronic
1090956721 11:131519599-131519621 AGAGGTGAACCTGCTTGTTAGGG + Intronic
1090956736 11:131519717-131519739 AGAGGTGAACCTGCTTGTTAGGG + Intronic
1090956751 11:131519835-131519857 AGAGGTGAACCTGCTTGTTAGGG + Intronic
1090956764 11:131519953-131519975 AGAGGTGAACCTGCTTGTTAGGG + Intronic
1092564093 12:9647383-9647405 AGAAAGGAATGTGCTTATTAAGG + Intergenic
1096808741 12:54156446-54156468 AGAAGGGAAGCTGCTTGCTTAGG + Intergenic
1097568521 12:61300958-61300980 ACCAGGCAATCTGCTTCCTACGG - Intergenic
1097851403 12:64413806-64413828 AGAAAGTAATATTCTTGCTAGGG + Intronic
1099118218 12:78653412-78653434 ACAAGGGAGTCTGGTTTCTATGG - Intergenic
1101141280 12:101798260-101798282 AGAAGGGAATGAGCTGGCAAAGG - Intronic
1101512347 12:105404708-105404730 AGAAGGGGCTATGCTGGCTATGG - Intergenic
1103031251 12:117615182-117615204 AGAAGGGAACATGCTTCCTCAGG - Intronic
1105759616 13:23502034-23502056 AAAAGGGAATCTTCTTGCTATGG - Intergenic
1106157146 13:27170281-27170303 AGTAGAGAATCTGCTTTTTAAGG + Intronic
1107456512 13:40560452-40560474 AGAAGGGGATGTGCATTCTATGG - Exonic
1111573509 13:90118652-90118674 AGAAAGGAATGTGCTTATTAAGG + Intergenic
1113066528 13:106378587-106378609 AGAATGGAAGGTGCCTGCTATGG + Intergenic
1119564513 14:75617003-75617025 AGGAGGGCATCTGTGTGCTAGGG + Intronic
1119634819 14:76265204-76265226 GGAAGGGAATGTCCTGGCTAAGG + Intergenic
1121191397 14:92033930-92033952 GGAAAGGAATGTGCTTTCTAAGG + Intronic
1121276851 14:92674170-92674192 AGGAGGGAAGGAGCTTGCTACGG + Intronic
1121987724 14:98524259-98524281 ATAATGGAACCTGCTTGCTAAGG - Intergenic
1127338026 15:58009521-58009543 AGAAGGCAGTCTGCTTTCCATGG - Intronic
1128108874 15:65063719-65063741 AGAAGGGATTCTGCTACCTAAGG + Intronic
1128446567 15:67767032-67767054 AGATGAGAATCTGCTGGCTGTGG + Intronic
1128679127 15:69634843-69634865 ACATGGGAATGTGCTTGCAATGG + Intergenic
1131074737 15:89487893-89487915 AGAAGGGAAGTGGCTTGCCAAGG - Intronic
1131191420 15:90319807-90319829 AAAAGGGACTCTGATTTCTATGG + Intergenic
1133417779 16:5619742-5619764 AGAAGGGAAGCAGCTTACTCAGG - Intergenic
1135717572 16:24785187-24785209 AGAAGGGAATCTGCATTATCAGG - Intronic
1140292366 16:73672196-73672218 AGATGGGAATATGCTTCCTAGGG - Intergenic
1145934594 17:28707328-28707350 GGAAGGGAAACTGATTGCTTGGG + Intronic
1147937154 17:44018721-44018743 TGATTGGAAACTGCTTGCTAAGG - Intronic
1149203944 17:54221699-54221721 AGATGAGAATCTCCTTTCTATGG - Intergenic
1149306464 17:55351648-55351670 AGAAAGGAATCTGATTTCCAGGG + Intergenic
1151212182 17:72552896-72552918 AAAAGGGAATCTCCTTTCCATGG + Intergenic
1153314501 18:3708585-3708607 ATGAGGGAATCTGTTTGCGATGG + Intronic
1155918098 18:31575638-31575660 AGAATAGCATCTGCTTGTTAGGG - Intergenic
1155922476 18:31616982-31617004 AGAAAGGGAGCTGCTTGCCATGG - Intergenic
1160621823 18:80176586-80176608 AGAAGGGCTGCAGCTTGCTATGG + Intronic
1162449778 19:10747843-10747865 AGAAGGGGAGCAGCTTCCTATGG + Intronic
1164408448 19:27976190-27976212 AGAAGAGAATCTGCATGCTTGGG + Intergenic
1165177265 19:33939361-33939383 AGAAGCTGTTCTGCTTGCTATGG - Intergenic
925057616 2:867191-867213 AGAAAGGAATGTGTTTACTAAGG + Intergenic
927672007 2:25076461-25076483 GGAAGGGAATCTACTTAATAGGG - Intronic
928309073 2:30194816-30194838 AGGATGGAATCTGCTTTCCAGGG + Intergenic
928445410 2:31329496-31329518 AGCAGGGAGTCTGATTCCTAAGG + Intergenic
929900012 2:45992703-45992725 AGAAGGTTGTCTGCTTGCTTTGG + Intronic
931213993 2:60224688-60224710 AGAAGGTAATCTGCTTTATTCGG - Intergenic
931695829 2:64869768-64869790 AGGAGGGCATCTGGTTGCTCAGG + Intergenic
932877842 2:75472235-75472257 GGAAAGGAATCTTCTTGGTATGG + Intronic
932970736 2:76537762-76537784 AGAAGGGTATCTTATTACTATGG - Intergenic
933102189 2:78274671-78274693 GGAAAGGAATGTGCTTGTTAAGG - Intergenic
933288177 2:80406898-80406920 AGCAGGCAAGCTGGTTGCTATGG - Intronic
933667143 2:84972123-84972145 AGCAGGGAGTTTGCTTGCTGCGG - Intronic
934749267 2:96781896-96781918 AGAAGGGAATTTCCTTGATCTGG - Intronic
935413025 2:102785926-102785948 AAATTGGAATCTGCTTGCTTTGG - Intronic
939095427 2:137828137-137828159 AGGAGGGAATCTGGTAGCCATGG + Intergenic
942963115 2:181856387-181856409 AGAGTTGAATTTGCTTGCTAGGG - Intergenic
943917306 2:193651845-193651867 ACAAGGTAATCTGCAAGCTAAGG + Intergenic
944083918 2:195821936-195821958 AGGAGGGAATCATCTTCCTAGGG - Intronic
945320315 2:208414036-208414058 GGAAAGGAATATGCTTACTAGGG + Intronic
947042288 2:225936933-225936955 AGATGGGAATGTGCTTGAGATGG - Intergenic
947153347 2:227136241-227136263 AGCAGGTAAGCAGCTTGCTAGGG + Intronic
947582171 2:231327052-231327074 AAGAGGGAAGCTGCTGGCTATGG - Intronic
1170038916 20:12019755-12019777 AAAAGGGCATCTGCTTATTAAGG - Intergenic
1170269837 20:14513194-14513216 AAAAGGGAATATCCTTGCAAAGG - Intronic
1170310256 20:14983960-14983982 AGAAGCCAATCTGATTGCTAAGG + Intronic
1171371185 20:24663191-24663213 TGAAGGCAGCCTGCTTGCTAAGG + Intronic
1172240461 20:33409404-33409426 AGAAGAGTCTCTGCCTGCTAGGG + Intronic
1175319796 20:58077414-58077436 AGGAGGGAATCTGTGTGCTGAGG - Intergenic
1176069632 20:63219279-63219301 AGACGGGAACCTTCTTGCTCGGG + Intergenic
1176916314 21:14629862-14629884 GGAAGGGAATCTTTTTGCAAAGG - Intronic
1182259666 22:29064299-29064321 AGGAGGGAATCTGCCTGTGATGG + Intergenic
1182537877 22:31019495-31019517 AGAAGGTAATTTGCTTTCTCAGG - Intergenic
950332569 3:12168226-12168248 ATAAGGGTATGTGCTTGATACGG + Intronic
952501231 3:33964046-33964068 AGAAGGGAACTTTCTTGCAAAGG - Intergenic
954706265 3:52482267-52482289 AGAAGGGAGCCTGCTTGCGAAGG + Intronic
956763364 3:72463102-72463124 GAAAGGAAATCTGCCTGCTAGGG - Intergenic
957538104 3:81532045-81532067 AGAAGAGAATCTGTTTGCTTAGG - Intronic
957903625 3:86530914-86530936 AGGTGGGAATCTGCTTGCCTGGG - Intergenic
960848610 3:122028356-122028378 AGGAGGAAAACTGCTTGGTATGG + Intergenic
960885268 3:122387484-122387506 AGAAGGGAATCAGCTTGCCAAGG + Intronic
961693483 3:128687439-128687461 ACATGGGAATGTGCTTGGTATGG + Intergenic
961871190 3:129989405-129989427 AGAAGGGAAGCTGCTTGCCTAGG + Intergenic
962953702 3:140244712-140244734 AAAAGGGAATCTGTTTGGGAAGG - Intronic
966157465 3:176932600-176932622 AGAAGTGTATTTGCTTGCTTTGG + Intergenic
966555198 3:181251315-181251337 AGAAAGGAATCTGATTCCCATGG + Intergenic
966643509 3:182216731-182216753 AGAAGGGACTATGCTTGATTTGG - Intergenic
970344755 4:15142894-15142916 AGAGGTTTATCTGCTTGCTAAGG + Intergenic
971364883 4:25969725-25969747 AGAAGACAATCTGATTGCAAAGG - Intergenic
973550653 4:52032316-52032338 AGAGGAGAATCTGCTTGTTGGGG - Intronic
973881217 4:55273250-55273272 AGAAGGGAACGAGCATGCTAAGG - Intergenic
975601675 4:76106651-76106673 AGAAAGGAATGTGCTTATTAAGG + Intronic
976369361 4:84269098-84269120 AAAAGGCACTCTGCTTGCTTTGG + Intergenic
977661058 4:99586761-99586783 AGAAAGGCATCTTCTTCCTAAGG + Intronic
978505798 4:109454672-109454694 AAGAGGGAATCTGGTTTCTAAGG - Intronic
986692041 5:10321078-10321100 AGAAGGGATTCTCCTTGATATGG - Intergenic
988332713 5:29863476-29863498 TCAAGGGCTTCTGCTTGCTAAGG + Intergenic
988710856 5:33773326-33773348 AGAAGGGAATGTGGTTCTTAAGG - Intronic
992787602 5:80184789-80184811 TGAAAGGAATGTGCCTGCTAAGG + Intronic
995237014 5:109840731-109840753 GGAAGGGAAACTGCCTGCTATGG + Intronic
995485394 5:112635289-112635311 AGAAGGGAAACTTCTGGGTAGGG + Intergenic
995749491 5:115439156-115439178 AGGAGGGAATCTACTTGCATGGG - Intergenic
998390572 5:141784604-141784626 AGACCAGAATCTGCTTTCTAAGG + Intergenic
998852322 5:146363106-146363128 AGAAGGGACACAGCTTGCTGAGG - Intergenic
999677014 5:154014666-154014688 AAGATGGAAACTGCTTGCTAGGG - Intronic
999805217 5:155074681-155074703 ATGAGGGATTCTACTTGCTATGG + Intergenic
1001322802 5:170696922-170696944 AGAAGGAAATGTGCATTCTAGGG - Intronic
1002682340 5:180976656-180976678 GGAAAGGAATGTGCTTACTAGGG + Intergenic
1003914586 6:10774869-10774891 AGAATAGAAACTCCTTGCTAGGG + Intronic
1005088924 6:22035798-22035820 AGAAGGTAATCTGAACGCTAGGG - Intergenic
1005162128 6:22876221-22876243 AAAAGGGATTCTGTTTTCTATGG - Intergenic
1005271293 6:24166202-24166224 AGAAGGGAACCTCCTGGCCAAGG + Intergenic
1006809433 6:36810492-36810514 AAAAGGGAATGTGCTTTCCAAGG + Intronic
1007320330 6:41023929-41023951 AGAAGGGAATTTGCTGCCTGAGG + Intergenic
1017591396 6:155981438-155981460 GGAAGGGAAGAAGCTTGCTATGG + Intergenic
1017827033 6:158089303-158089325 AGAGGGGAAGCTGGGTGCTAGGG + Intronic
1018445146 6:163851124-163851146 AGAAGGAAATCTGCATACAAGGG - Intergenic
1024570958 7:50722483-50722505 AGATGGGAATGTGCTTTCTGTGG - Intronic
1026979424 7:74517893-74517915 AGCAGGGAACCTGCTTGGTGGGG + Intronic
1030532022 7:110723025-110723047 ACAAGGGAATCTGCCTATTAAGG - Intronic
1032396151 7:131591605-131591627 AGAAGGGAAGCCCCTTGCTTGGG + Intergenic
1034847919 7:154464286-154464308 GGCAGAGAATCTGCTTGCTTGGG - Intronic
1036578452 8:10050869-10050891 AGCAGGTAGTCTGCCTGCTAAGG - Intergenic
1039166538 8:34687612-34687634 ACAAGGGAATCTCCCTGCTATGG - Intergenic
1039858733 8:41438280-41438302 AGAAGGGATTCTCCCTGCTCTGG - Intergenic
1043948029 8:86276029-86276051 AGAAGGGAAGATGCTTGTTCAGG + Intronic
1045186042 8:99839150-99839172 AGAAGGGAATTTACCTGCAAAGG - Intronic
1047694325 8:127387987-127388009 AAAAGGGAATAAGCTTGGTATGG - Intergenic
1047993181 8:130307949-130307971 AGGAAGGAAGCTGCTTGCTGAGG - Intronic
1048002006 8:130386292-130386314 AGAAGGGAATGTACTGGCTTAGG - Intronic
1048137903 8:131764081-131764103 ACATGGCAATCTTCTTGCTATGG - Intergenic
1049736502 8:144209673-144209695 ATAAAGCGATCTGCTTGCTACGG - Intronic
1051920579 9:22259239-22259261 CAAAGGGGCTCTGCTTGCTATGG - Intergenic
1058841942 9:108918364-108918386 AGCAGAGGATCTGCTTGCCAAGG - Intronic
1058994647 9:110287815-110287837 AGAGGGGAATATGCTAGCCAAGG + Intergenic
1059284059 9:113157697-113157719 AGAAAGGAATCTGCATCATAGGG - Intronic
1062463652 9:136672045-136672067 GGAAGGAAATCTGCTCGCTCAGG - Exonic
1186063707 X:5738997-5739019 AGAAAGGAATGTGCTTACTAAGG - Intergenic
1186134627 X:6505981-6506003 AAAAGGGATTCTGGTTTCTAGGG + Intergenic
1187674288 X:21700482-21700504 AGAAGAGAATCTGGTGGCTTGGG - Intergenic
1190391951 X:49940837-49940859 AGAAGGGATTCTGGGAGCTATGG + Intronic
1191706936 X:64103689-64103711 AGAAGGGGATCTAGTTGGTAAGG + Intergenic
1191723851 X:64258569-64258591 AGGAGAGGATCTGCATGCTACGG - Intergenic
1193355225 X:80512519-80512541 GGAAAGGAATGTGCTTACTAAGG + Intergenic
1194193857 X:90868810-90868832 GGAAAGGAATGTGCTTGTTAAGG - Intergenic
1194266855 X:91764750-91764772 AGAAGGGAATGTCTTTGTTAAGG - Intergenic
1194987982 X:100511945-100511967 AGAACTGAATCTTCTTGCTGGGG + Intergenic
1195350883 X:103996129-103996151 ATGAGGGATTCTGCTTTCTATGG - Intergenic
1195968520 X:110450680-110450702 AGAAGGCCATCTGCTTGTTTTGG - Exonic
1200384066 X:155871002-155871024 AGAAGGGAATCAACTTAATAGGG + Intergenic
1200540467 Y:4451194-4451216 GGAAAGGAATGTGCTTGTTAAGG - Intergenic
1200584055 Y:4985662-4985684 AGAAGGGAATGTCTTTGTTAAGG - Intergenic
1201754328 Y:17469724-17469746 AGAAAGGAAGCTGCTTTCTGAGG + Intergenic
1201847224 Y:18436261-18436283 AGAAAGGAAGCTGCTTTCTGAGG - Intergenic