ID: 1071433548

View in Genome Browser
Species Human (GRCh38)
Location 10:85625642-85625664
Sequence GGGAGCAGGTAGACTGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 343}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071433548_1071433558 16 Left 1071433548 10:85625642-85625664 CCCTTCTCAGTCTACCTGCTCCC 0: 1
1: 0
2: 3
3: 39
4: 343
Right 1071433558 10:85625681-85625703 GAAAAAAATTGACATGGTGAGGG No data
1071433548_1071433559 23 Left 1071433548 10:85625642-85625664 CCCTTCTCAGTCTACCTGCTCCC 0: 1
1: 0
2: 3
3: 39
4: 343
Right 1071433559 10:85625688-85625710 ATTGACATGGTGAGGGAGTCTGG No data
1071433548_1071433553 -6 Left 1071433548 10:85625642-85625664 CCCTTCTCAGTCTACCTGCTCCC 0: 1
1: 0
2: 3
3: 39
4: 343
Right 1071433553 10:85625659-85625681 GCTCCCTGGGTTGTTGCAAAAGG No data
1071433548_1071433556 10 Left 1071433548 10:85625642-85625664 CCCTTCTCAGTCTACCTGCTCCC 0: 1
1: 0
2: 3
3: 39
4: 343
Right 1071433556 10:85625675-85625697 CAAAAGGAAAAAAATTGACATGG No data
1071433548_1071433557 15 Left 1071433548 10:85625642-85625664 CCCTTCTCAGTCTACCTGCTCCC 0: 1
1: 0
2: 3
3: 39
4: 343
Right 1071433557 10:85625680-85625702 GGAAAAAAATTGACATGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071433548 Original CRISPR GGGAGCAGGTAGACTGAGAA GGG (reversed) Intronic
900163739 1:1236547-1236569 GGGAGCAGGTGGCCAGAGACAGG + Intergenic
900671127 1:3855676-3855698 GGGAGGGGGTAGACTAAAAAAGG - Intronic
901019558 1:6248980-6249002 GGGAGCAGGGAACCTGAGACAGG - Exonic
902132888 1:14279187-14279209 AGGAGCAGACAGACTGGGAAAGG + Intergenic
902242785 1:15099932-15099954 GGGAGCTGGGTGACAGAGAAGGG + Intronic
902757050 1:18555876-18555898 GGGAGCAGGTAGATTGCCCAGGG - Intergenic
903219394 1:21860392-21860414 GGGTGCTGGTGAACTGAGAAAGG + Intronic
903606418 1:24578291-24578313 GGGAGCACATAGACAGAGGAAGG - Intronic
903935567 1:26892582-26892604 GGGAGCAGGGAGAATGGGGATGG + Intronic
904933775 1:34111896-34111918 GGGGGCAGGGAGACAGAGACAGG - Intronic
905907426 1:41628235-41628257 GGGGGCAGGTGGGGTGAGAAAGG + Intronic
905988042 1:42305726-42305748 GGTATCAGGGAGAGTGAGAATGG + Intronic
906698744 1:47842407-47842429 GGGACCAGGCAGAATAAGAAAGG - Intronic
906857468 1:49323655-49323677 GGGTGCCGGTAGACTGAGGCAGG + Intronic
907132271 1:52107632-52107654 GGGAGGAGGGAGAATGGGAAAGG - Intergenic
907463515 1:54620226-54620248 GGGGGCAGGTTCACAGAGAAGGG + Intronic
907719638 1:56959791-56959813 GGAAGCTAGTAGAGTGAGAAAGG + Intronic
916716007 1:167447288-167447310 GGGATAAGGTAGATTGAGAAGGG - Intronic
916805151 1:168252157-168252179 AGGAGCAGATAAACTGATAATGG + Exonic
916880448 1:169015364-169015386 AGGAGGAGGGAGACTCAGAAGGG + Intergenic
917306002 1:173625643-173625665 AGAAGCAGGTAGACTTAGAGAGG + Intronic
917779181 1:178373446-178373468 GGAAGCAAGTAGAATGAGATAGG - Intronic
918039129 1:180901530-180901552 GGGAGGAGGTGGATTGAGAAGGG + Intergenic
918461329 1:184779793-184779815 AGGAACAGGTAGACTTATAAGGG + Intergenic
918860073 1:189813106-189813128 GAGAGTAGGTAGCCAGAGAAAGG - Intergenic
919217627 1:194579971-194579993 GGGAGTGGGAAGACTGAGAGAGG + Intergenic
920077707 1:203349301-203349323 GGGAGCAGGTAGCTTGGGAAAGG - Intronic
920227600 1:204449788-204449810 GGGAGGAGGGGGACAGAGAAAGG - Intronic
920308734 1:205035525-205035547 AGAAGAAGGTAGACTGAGGAAGG + Intergenic
922063322 1:222112265-222112287 GGGAGCAGGTATAGTGAGTGTGG - Intergenic
1063170631 10:3506814-3506836 AGGTGGAGTTAGACTGAGAAAGG + Intergenic
1063812720 10:9732117-9732139 GGGAGCAGGCAGCTGGAGAACGG + Intergenic
1067293787 10:44962824-44962846 GGGAGCAGGAGGACTGGAAATGG + Intronic
1067819528 10:49515983-49516005 GGCAACAGGTACAGTGAGAAAGG - Exonic
1067844701 10:49710480-49710502 GGGACCACATAGACTGAGAGTGG - Intergenic
1068197750 10:53740237-53740259 TGGGGCAGGAAGACTGAGAGGGG + Intergenic
1070106152 10:73433316-73433338 GGGAGAAGGAAGACTGAAACTGG + Intronic
1071433548 10:85625642-85625664 GGGAGCAGGTAGACTGAGAAGGG - Intronic
1072265997 10:93728484-93728506 GGGAGCTGGGAGACGTAGAAAGG + Intergenic
1072555206 10:96509544-96509566 GGGAGCAGGAGGAATGAGACAGG - Intronic
1073103761 10:101020719-101020741 GTGAGGAGGGAGAGTGAGAATGG + Intronic
1073445727 10:103579172-103579194 GGGAGGAGACAGACTGAGGAGGG - Intronic
1073479446 10:103777328-103777350 GGCGGCAGGGAGACTGAGAGGGG + Intronic
1074161185 10:110837527-110837549 TTGGGCAGGCAGACTGAGAAGGG + Exonic
1074518978 10:114199485-114199507 GGAAGCAGGAAGAATGGGAAGGG - Intronic
1075054758 10:119209013-119209035 GGTAGAAGGCAGACTGAGTAAGG + Intronic
1076082462 10:127595489-127595511 GGGATGAGGCAGACTGAGACAGG - Intergenic
1076284648 10:129281535-129281557 GGGAGTATTTAGACAGAGAAGGG - Intergenic
1076586393 10:131551085-131551107 GGGAGGAGGCAAACTGGGAAAGG - Intergenic
1077554324 11:3218659-3218681 TGCAGCAGGTAGATGGAGAAGGG + Exonic
1078427581 11:11264564-11264586 GTGAGCAGATATACTGAGACTGG + Intergenic
1078826851 11:14938103-14938125 GGGATCAGGTAGAGGGTGAATGG - Intronic
1081655559 11:44854777-44854799 GGAAGCAGAGAGACAGAGAAGGG - Intronic
1081662726 11:44897852-44897874 GGGCAGAGGTACACTGAGAAGGG - Intronic
1082730062 11:56785168-56785190 GTGAGTAGGTAGACTGAGGTGGG - Intergenic
1083185242 11:61013854-61013876 GGAACCAGGTAGACTGGGAGAGG + Intronic
1083278427 11:61610798-61610820 TGGAGCAGGTTGAATGGGAAAGG + Intergenic
1083301646 11:61742737-61742759 GGCAGCAGGGAGACAGGGAAGGG - Intronic
1083619233 11:64040774-64040796 GGGTGCAGGCAGAGGGAGAAGGG + Intronic
1083683833 11:64364257-64364279 GGGAGCAGGAGGAAGGAGAAGGG + Intronic
1083777658 11:64902131-64902153 GGGAATAGGTAGACGGAGATGGG + Exonic
1084551153 11:69842977-69842999 GGAAGCAGGTAAACTGAGGAAGG - Intergenic
1084742268 11:71147349-71147371 GGGAGAAGGAAGACAAAGAACGG + Intronic
1084857638 11:71999143-71999165 GGGAGTGGGTAGCCTGGGAAAGG + Exonic
1085646463 11:78226692-78226714 GGGATCTGGTAGGCTGAGAGTGG + Exonic
1088316331 11:108510519-108510541 GAAAGCAGGTTGAGTGAGAACGG - Exonic
1088360138 11:108980945-108980967 GGAAGCTGGAAGTCTGAGAAGGG - Intergenic
1089018704 11:115188784-115188806 GGGAGCATATTGATTGAGAAAGG - Intronic
1089689100 11:120175486-120175508 GGGAGAAGGTGGGCTGAGAGTGG - Intronic
1090393352 11:126403687-126403709 GGGAGCAGGGAGGGTGAGAGAGG + Intronic
1090406631 11:126479689-126479711 GGGAGCAGGCAGCCTGTGAAGGG - Intronic
1090596419 11:128325339-128325361 GGGAGAAGGTAGATGGAGCAAGG + Intergenic
1090962884 11:131572858-131572880 GGGTGCAGGTGGAGTGAGAACGG + Intronic
1091972235 12:4797116-4797138 GGGAGAAGGTGGACTGTGAAGGG + Intronic
1092279029 12:7085860-7085882 GGCAGCAGGGAGTCTGAGCAAGG - Exonic
1092763912 12:11835549-11835571 GGGAGCAAGTAGCCTGTGAAGGG + Intronic
1093257377 12:16886700-16886722 GGGAGCAGGTAGAAGGAGCCAGG - Intergenic
1093721833 12:22452388-22452410 GGGAGAAGAAAGATTGAGAAAGG - Intronic
1094034408 12:26052001-26052023 GGCACCAAGTAGACTGAGAAAGG + Intronic
1095945896 12:47753302-47753324 GGGTGTAGGGAGACTGAGAATGG - Intronic
1096227887 12:49881158-49881180 GGGGGCAGGGAGACTGTGCATGG - Intronic
1096374408 12:51096413-51096435 GGGAGAAGGGAGTTTGAGAAGGG - Intronic
1097021993 12:56027145-56027167 GGGAGTGGGTAGCCTCAGAAAGG + Intronic
1097107282 12:56633240-56633262 GGGAGGAGGAAGAGAGAGAAGGG + Intronic
1099987163 12:89679897-89679919 GGGAGAAGATAAACAGAGAAGGG + Intronic
1100297400 12:93275598-93275620 GGGACCAGGAAGAAAGAGAAGGG + Intergenic
1100817132 12:98397294-98397316 GGCAGCAGGTAGGCAGGGAAGGG + Intergenic
1100878492 12:98989983-98990005 GGGAGGAAGGAGACAGAGAAAGG + Intronic
1101299980 12:103469158-103469180 GGGAGCAGGGAGCTTGGGAAGGG + Intronic
1104193840 12:126511379-126511401 GGCAACAGGTACAGTGAGAAAGG - Intergenic
1105402117 13:20105150-20105172 GTGAGCAGCTGGACTGAGGACGG - Intergenic
1107653822 13:42572081-42572103 AGCAGCAGGTAGACTGACAGTGG + Intronic
1107993810 13:45841442-45841464 TGGAGCAAGTAGCCTGAGAAAGG - Intronic
1108606804 13:52047477-52047499 GGTAGTAGGAAGACTGAAAAGGG + Intronic
1109771836 13:66984913-66984935 GGGAACAGGGAGATTGAGATGGG - Intronic
1110023399 13:70505574-70505596 GGTAGCAGGTAGAAGGAGAGGGG + Intergenic
1113120983 13:106923716-106923738 GGAAGCAGCTTGGCTGAGAAGGG + Intergenic
1113181851 13:107637857-107637879 TGGATGAGGTAGACAGAGAATGG - Intronic
1114198324 14:20499016-20499038 AGTAGCAGGCAGACTAAGAAGGG + Intergenic
1114690139 14:24573823-24573845 AGGAGAAGGGAGACTGAGACAGG + Intronic
1114751814 14:25212826-25212848 GGGTGGATGTTGACTGAGAATGG - Intergenic
1115028642 14:28768489-28768511 GCGAGCAGGTTGACGGAGCAGGG - Exonic
1115473737 14:33794750-33794772 GGCAGAATGTAGACTGGGAAGGG - Intronic
1115886006 14:37972133-37972155 TAGAGCAGGTAGAGGGAGAATGG + Intronic
1116951799 14:50885148-50885170 GAGAGCAGGAAGGCTGAGCAGGG - Intronic
1117403994 14:55383918-55383940 GGAAGCAGGCAGTCTGGGAAGGG + Intronic
1118363124 14:65072379-65072401 GGGAGCACGTAGACTCATCAAGG + Intronic
1119712722 14:76834594-76834616 GGCAGCAGGTGGTGTGAGAATGG + Intronic
1119916181 14:78404238-78404260 GGGAGCAGGCAGACAGAAACAGG + Intronic
1120866889 14:89302783-89302805 GGGTGGAGGTGGACAGAGAAGGG - Intronic
1122096600 14:99376890-99376912 GGGAGCTGGTGGACTGAGGCCGG + Intergenic
1122391909 14:101395237-101395259 TGCAGCAGGTGGACTGAGGATGG - Intergenic
1127146262 15:56027289-56027311 GGAAGCAGAGAGACTGGGAAGGG - Intergenic
1127311385 15:57754801-57754823 GGGAGCAGGTGGAGAGTGAAGGG + Intronic
1127338281 15:58012773-58012795 GGTAGGAGGGACACTGAGAAAGG + Intronic
1128008236 15:64265970-64265992 GCTAGTAGGTAGACTGAGATGGG + Intronic
1128317788 15:66671899-66671921 AGGAGGAGTGAGACTGAGAAAGG + Intronic
1130117187 15:81015396-81015418 GGGAGCAGGTAGGATGTGGAAGG - Intronic
1131412991 15:92226604-92226626 GTCAGAAGGCAGACTGAGAAAGG + Intergenic
1133336597 16:5010684-5010706 GGGATCAGGGAGAGTGAGAAAGG - Intronic
1133527803 16:6623315-6623337 GGGAGCAGAGATGCTGAGAAGGG + Intronic
1133858343 16:9570938-9570960 GGGAGCAAGTGGCCTGAGGAAGG + Intergenic
1136525343 16:30826018-30826040 GGGAGAATGTGGACTGAGATGGG - Intergenic
1137536090 16:49327370-49327392 GGGAGAAGTTAGACAGGGAAGGG - Intergenic
1137567567 16:49542991-49543013 GGAAGCTGGTAGGCTGGGAAGGG - Intronic
1137781654 16:51102797-51102819 GGGGGCAGGGAGACTTGGAAAGG + Intergenic
1137784392 16:51125976-51125998 GGGAGATGCTAGACAGAGAAAGG - Intergenic
1138332475 16:56226147-56226169 GGGAGCAGGGAGACCAAGGAGGG + Intronic
1138463200 16:57166046-57166068 GGGAGGAGTTATCCTGAGAAGGG - Intronic
1138659349 16:58508441-58508463 GGGAGCAGGTGGCCTGAGGCTGG + Intronic
1139221288 16:65185120-65185142 GGGAGAAGGTGGGCTGAGCATGG - Intergenic
1139256722 16:65549729-65549751 GGGTGCAGGTAGATGTAGAATGG - Intergenic
1139476150 16:67203462-67203484 GGGAGCGGGGACACTGAGCAGGG - Intronic
1139506961 16:67403458-67403480 GGGAGCAGGGAGAGAGACAAGGG + Intronic
1140133458 16:72184193-72184215 GGGAGGATGTAGAGTGAGAATGG - Intergenic
1140919596 16:79525022-79525044 GGGAGCTGGTGGACTAAGAATGG - Intergenic
1140929839 16:79617306-79617328 GAGAGCAGGGACACTGAGATGGG + Intergenic
1141470466 16:84234879-84234901 GAGAGCAGGGAGGCTGAGGACGG - Intronic
1143072901 17:4312417-4312439 GGCACAAGGTAAACTGAGAAAGG + Intronic
1143844608 17:9764641-9764663 GGGAGCTGGAAGAATGAGACAGG + Intergenic
1144058160 17:11559482-11559504 CTGAGCAGGTAGACAGAGATGGG - Exonic
1144149496 17:12429714-12429736 GGGAGCAGAAAGAAAGAGAATGG - Intergenic
1144303654 17:13947622-13947644 GGAACCACGTAGACTGAGGAGGG - Intergenic
1144430549 17:15187555-15187577 GTGAGGAGGGAGACTTAGAAAGG + Intergenic
1144437597 17:15255542-15255564 GGAAGTAGGTAGCCTGAGAGAGG - Intronic
1144517443 17:15928448-15928470 TGGAGCAGGGAGGCTGAGCATGG + Intergenic
1144615011 17:16761372-16761394 TGAAGAAGGTAGACTGAGAATGG - Intronic
1144897694 17:18554297-18554319 TGAAGAAGGTAGACTGAGAATGG + Intergenic
1145134678 17:20391422-20391444 TGAAGAAGGTAGACTGAGAATGG - Intergenic
1146526744 17:33573206-33573228 TGGAGCAGGAAATCTGAGAAAGG - Intronic
1146668486 17:34720777-34720799 GGCACCAGGCAGACTGTGAATGG + Intergenic
1146675911 17:34773741-34773763 GGGTACAGGTTGAATGAGAAGGG - Intergenic
1146979779 17:37149739-37149761 GGGAAGAGATAGACTGAGGAAGG + Intronic
1147672689 17:42185649-42185671 GGGAGCAGATAGACAGACAAGGG - Intergenic
1147917368 17:43896772-43896794 TGGAGCAGGAAGATTCAGAAGGG - Intronic
1148211074 17:45809008-45809030 GGGAGCAGGGAGGCTAAGCAGGG + Intronic
1148625553 17:49066524-49066546 GGGAAAAGGTAGAGTGAAAATGG - Intergenic
1149420174 17:56502887-56502909 GGGAGTAGGTGGATGGAGAATGG + Intronic
1149527162 17:57365693-57365715 GGGAGGAGATAGTGTGAGAAAGG + Intronic
1149721758 17:58851988-58852010 GGCAGCAGCTAGGCTGAGGAAGG - Intronic
1150281251 17:63930834-63930856 GGGAGGGGGTCGACTGAGGAAGG - Intronic
1151178741 17:72310633-72310655 GGAATCGGGTTGACTGAGAAGGG + Intergenic
1152526162 17:80889402-80889424 GGGAGCAGGAGGACAGACAATGG + Intronic
1152633168 17:81419726-81419748 GGGAGCCGGGAGCCTGGGAAGGG + Intronic
1152764225 17:82127352-82127374 GGGCGCAGGCTGACTTAGAATGG - Intronic
1152764231 17:82127389-82127411 GGGCGCAGGCTGACTTAGAATGG - Intronic
1153423744 18:4938558-4938580 GGGGTCAGGTAGACAGACAATGG + Intergenic
1155600509 18:27540675-27540697 GGGAGCTGGGAGATGGAGAAGGG - Intergenic
1156245574 18:35294630-35294652 GGGTGGAGGAAGAGTGAGAATGG - Intergenic
1156364770 18:36415363-36415385 GGGAGCAGTGAGGCTGAGATAGG + Intronic
1156497185 18:37533699-37533721 GGGAGCAGCTACTGTGAGAATGG + Intronic
1157159540 18:45300891-45300913 GGGAGCTGGCAGCCTGATAAAGG + Intronic
1157491982 18:48129923-48129945 GGGAGCAGGGAGGCAGAGGAGGG - Intronic
1157533509 18:48441768-48441790 GGCAGCTGACAGACTGAGAAGGG - Intergenic
1157565822 18:48678517-48678539 GGTAGCAGGTCCACTGGGAAGGG + Intronic
1157688771 18:49664171-49664193 TAGAGCAGGTGGAATGAGAAAGG - Intergenic
1160345294 18:78127471-78127493 AGGAGCAGGAAGAAAGAGAAAGG - Intergenic
1160423475 18:78765211-78765233 TGGAGCAGGGAGACGGAGAGTGG - Intergenic
1160665615 19:326671-326693 GGGATCAGGTGGATGGAGAATGG - Intronic
1161475645 19:4483381-4483403 GGGAGCCGGGAAACTGAGGAAGG + Intronic
1163009931 19:14418823-14418845 AGAAGAAGGTAGACTGGGAAAGG + Intronic
1163062611 19:14771350-14771372 AGTAGCAGGTGGACAGAGAAGGG - Intronic
1163196280 19:15723345-15723367 GGGAGCAGGAAGGCTGAGCCGGG + Intergenic
1163378602 19:16949510-16949532 GGGAGATGTTAGACTCAGAATGG - Intronic
1163779966 19:19240937-19240959 GGGACCAGGCAGAGTGAGTAGGG - Intronic
1164503774 19:28841387-28841409 GGGAGAAGGTGGACAGAGGAAGG + Intergenic
1165348361 19:35262815-35262837 GGGAGAAAGTAGGCTGAGGAGGG + Intronic
1165393168 19:35549833-35549855 GTAAGCAGGTAGGCTCAGAAAGG + Intergenic
1165693406 19:37882246-37882268 GGGAGCAGGAAGACTCAAAAAGG - Intergenic
926803572 2:16684009-16684031 GGGAGCAGATACAAAGAGAAGGG - Intergenic
929619594 2:43341356-43341378 GGGAGCAGAGGGAATGAGAATGG + Intronic
930392326 2:50777821-50777843 TGGAGAAGCTAGACTCAGAATGG - Intronic
930464040 2:51721900-51721922 GGGAAGATGTAGACAGAGAAAGG + Intergenic
931781152 2:65580269-65580291 GGGAGCAGGAAGTCGGAGAGAGG - Intergenic
932698550 2:73977403-73977425 GAGAGCAGGAAGCCTGAGAAAGG + Intergenic
933294203 2:80471195-80471217 GGAAGCAGGAAGACTGAGTAGGG + Intronic
935863744 2:107362732-107362754 GGGATCAGGTGGGATGAGAAGGG + Intergenic
936086603 2:109473741-109473763 GGGAGGAGGTAGCCTGAGGCAGG - Intronic
937036045 2:118783208-118783230 GTGGGCAGGTAGACAGAAAATGG + Intergenic
937127020 2:119481517-119481539 AGGAGCAGGGAGACTCAGAGTGG - Intronic
937856038 2:126672583-126672605 GGGAGCAGGGAGAATGTGCATGG + Intronic
938395640 2:130945693-130945715 AGCAGCAGGTAGACTGGGGAAGG - Intronic
938969556 2:136419830-136419852 GGGAGAAGGGAGACGGGGAAAGG - Intergenic
939457869 2:142461758-142461780 GGGAGCAGGTAGACACTGCATGG - Intergenic
942133694 2:172905064-172905086 GGGAGCAGGTCGAGTGTTAAGGG - Intronic
942495827 2:176539030-176539052 GTGGGAAGGTAGACAGAGAAAGG - Intergenic
943386353 2:187207999-187208021 GCAAGCAGGTAGACTGAGGCTGG - Intergenic
947108565 2:226694190-226694212 GGGAATATGAAGACTGAGAAAGG - Intergenic
947669612 2:231927878-231927900 GGGAAGGGGTAGCCTGAGAAAGG - Intergenic
948091887 2:235302052-235302074 GGGAGGAGGAAGAGAGAGAAGGG - Intergenic
948097014 2:235343525-235343547 GGGAGCCTGGAGACTGAGGAAGG + Intergenic
1168799118 20:633404-633426 GGGAGAAGCCAGGCTGAGAACGG - Intergenic
1169887727 20:10419733-10419755 ACGAGCAGGTAGACAGACAAGGG + Intronic
1170098180 20:12669910-12669932 CGGAGGAGGTAGAGAGAGAAAGG - Intergenic
1170441832 20:16386964-16386986 AGGGGCAGTTAGTCTGAGAAAGG + Intronic
1172213249 20:33215729-33215751 GGGAGCATGAACTCTGAGAAAGG + Intergenic
1172615835 20:36283618-36283640 GGGTGCAGGTATACTGGAAAGGG - Intergenic
1173620773 20:44434381-44434403 GGGATCAGGTAGACAGCGAATGG - Intergenic
1173854016 20:46238132-46238154 GAAAGCAGGTAGCCTGGGAAAGG - Intronic
1173927773 20:46793465-46793487 TGGAGCTGGAAGTCTGAGAAGGG + Intergenic
1173961580 20:47076796-47076818 GGGAGGAGCTTGCCTGAGAACGG - Intronic
1175597617 20:60247827-60247849 GGGAGAAGAGAGAGTGAGAAAGG - Intergenic
1176411743 21:6452836-6452858 GGGAGCAGGGAGACTGAGACAGG + Intergenic
1176513111 21:7763485-7763507 GGGAGAAGGAACACTGAGGAAGG - Intronic
1178647224 21:34394009-34394031 GGGAGAAGGAACACTGAGGAAGG - Intronic
1179019018 21:37621361-37621383 GGGAACTGGTGGACAGAGAAAGG - Exonic
1179029221 21:37705249-37705271 TGGAGCAGATAGACTGGGGAAGG + Intronic
1179687237 21:43061158-43061180 GGGAGCAGGGAGACTGAGACAGG + Intronic
1182433226 22:30313083-30313105 GGAAGTAGCTAGGCTGAGAAAGG + Intronic
1182462123 22:30490529-30490551 GGGAGCAGGCGGCCTGGGAACGG + Intronic
1183425209 22:37735398-37735420 GGGAGCAGGAGCACTGCGAAGGG + Exonic
1184169263 22:42749371-42749393 GGGAGCAGCCAGCCTGAGGACGG - Intergenic
1185151966 22:49168960-49168982 GGGTGCAGGTGCACAGAGAAAGG + Intergenic
950135908 3:10580637-10580659 GGGAGCAGGGAGACAGGGAGGGG - Intronic
950907702 3:16554020-16554042 GAGAGCAGGTACCCTGATAAGGG + Intergenic
951569432 3:24046635-24046657 GGGAGAAGGTAGACAAAGGAGGG - Intergenic
951641805 3:24844816-24844838 GGGAGCAGGGAGAAAGAGGAGGG - Intergenic
952216570 3:31284056-31284078 GGGAACAGCTAGACTGAGAGTGG - Intergenic
953215645 3:40915239-40915261 GGGAGCAGGTAGGAACAGAAAGG - Intergenic
953232499 3:41077303-41077325 GGGAGCAGGAAGATTGAGCAGGG - Intergenic
953620824 3:44531215-44531237 GGAAGGAGGGAGACAGAGAAGGG + Intergenic
953659982 3:44884853-44884875 GGGAGCGGGCAAACTGAGGAGGG - Intronic
955239073 3:57164321-57164343 GGGAGCAGGGAAGCTGAGAGGGG + Intronic
955274979 3:57538689-57538711 GTGAGCAAGTGAACTGAGAAAGG - Intronic
955559139 3:60169848-60169870 GGGAGGAGGTAGAATAAAAATGG + Intronic
955754974 3:62217472-62217494 GAGAGAAGGTAGGCTGAGTAGGG - Intronic
956514604 3:70033224-70033246 GGAGGTAGGAAGACTGAGAAAGG - Intergenic
960436429 3:117632585-117632607 GGGAGCAGGGAGATAGAGAAGGG + Intergenic
961754475 3:129119971-129119993 TGGAGCAGGTAGCCAGGGAAGGG - Intronic
962729003 3:138262210-138262232 AAGAGTAGGTAGACTGAGAAAGG + Exonic
962760554 3:138509255-138509277 GGGAGCAGGAAGCATGGGAAGGG + Intronic
963184954 3:142404565-142404587 GGGAGCAGAAACACTGACAATGG + Intronic
963196491 3:142536680-142536702 GGGGGCAGGTAGACTGGGCTGGG - Intronic
965447361 3:168791662-168791684 GGTAGAGGGTAGACTGGGAAGGG + Intergenic
967068557 3:185942112-185942134 GGGAGTAGGGAGACTATGAAAGG + Intergenic
967382333 3:188872946-188872968 GTGAGCAAGCAGACTGAGAGAGG - Intronic
968122921 3:196138743-196138765 GTGAGCATGTAAACTGATAAGGG - Intergenic
968711455 4:2122375-2122397 GGGAGGAGGGACACAGAGAAAGG + Intronic
968744497 4:2352698-2352720 GGCAGCGGGAAGCCTGAGAAGGG + Intronic
968818344 4:2833131-2833153 GGCAGCGGGTAGACTGAGACTGG + Intronic
969663826 4:8545561-8545583 GGAAGCAGGTAGAGTGAGTAGGG - Intergenic
970040376 4:11790669-11790691 GAGACCAGGTAGTCTGGGAATGG - Intergenic
972371197 4:38424799-38424821 GGGAACAGGAAGGCTGACAAGGG - Intergenic
972604465 4:40601224-40601246 TTGAGCAAGTAGACTCAGAAAGG - Intronic
974832278 4:67204463-67204485 GAGAGAGGGTTGACTGAGAAAGG - Intergenic
975408513 4:74020592-74020614 GAAAGCACGTAGACTGAGAGCGG + Intergenic
977874015 4:102128281-102128303 GGGAGCAGGCATAGTGAGAATGG - Intergenic
978006596 4:103624966-103624988 GGGAGCAGCAAGACAGGGAAAGG + Intronic
978173586 4:105703591-105703613 GGGTGCAGGCAGAGAGAGAATGG - Intronic
979161664 4:117469140-117469162 TGGAGCAGGTAGAGTGAGCTAGG + Intergenic
981120050 4:141039387-141039409 GGGAGGAGGTAGAGAAAGAAAGG + Intronic
981165058 4:141548075-141548097 GGGGGAAGGTAGAAAGAGAATGG - Intergenic
983616887 4:169716712-169716734 GGGAGCAGGAGGATAGAGAATGG - Intronic
984593778 4:181644792-181644814 GAGAGGAGGTAGACAGAGATTGG - Intergenic
986406411 5:7429181-7429203 AAGAGCAGGTACAGTGAGAAGGG + Intronic
986872591 5:12067569-12067591 GGGACAAGGTAAACTTAGAAAGG + Intergenic
988334017 5:29881806-29881828 GGCAACAGGTACAGTGAGAAAGG - Intergenic
988934626 5:36069746-36069768 GGAAGCAGGTTCACTGTGAATGG - Intronic
989004130 5:36790962-36790984 GGGAGCAGCTGGACTGAGGCAGG + Intergenic
990699334 5:58459396-58459418 GGGAGCAGATAGAGGGAGAGAGG + Intronic
991671379 5:69051494-69051516 GGGTGGAGATGGACTGAGAAGGG + Intergenic
991674333 5:69076238-69076260 GGAAGCAGGGAGTCTGAGATGGG - Intergenic
992182669 5:74213355-74213377 TGGGGCAGGTAGATTGAGGAAGG + Intergenic
992205227 5:74424224-74424246 GGGTGCAGGCATGCTGAGAATGG - Intergenic
992388940 5:76312711-76312733 GGAAGAAGGTAGGCAGAGAAAGG - Intronic
995138181 5:108702802-108702824 GTGAGGAGGTAGACAGAGAAGGG - Intergenic
997623531 5:135316196-135316218 GGCAGAAGGTAGGCTGAGAAAGG - Intronic
999263435 5:150251624-150251646 GGGAGCATGAAGACTGACCAGGG - Intronic
999303460 5:150505238-150505260 GGGAGCAGGTAGGCAGGGATGGG - Intronic
999945638 5:156592320-156592342 GTGAGGAGGGAGATTGAGAATGG - Intronic
1001133560 5:169083914-169083936 GAGAGCAGGTTTACTAAGAAAGG - Intronic
1001276651 5:170356073-170356095 GGGAGCAGGGTAGCTGAGAAAGG + Intronic
1003158653 6:3617602-3617624 GTGTGGAGGGAGACTGAGAAGGG + Intergenic
1003542576 6:7031593-7031615 GGGATCTGGAGGACTGAGAAGGG - Intergenic
1004209635 6:13625977-13625999 GGGAGGAAGTTGAATGAGAATGG - Intronic
1004272719 6:14210241-14210263 GGGAGCAGATGGCCTCAGAAGGG - Intergenic
1005155619 6:22802784-22802806 GGGTGGAAATAGACTGAGAAAGG + Intergenic
1007009197 6:38398571-38398593 GTGAGCAGGTAGACAGAGGATGG - Intronic
1007681099 6:43633979-43634001 GGGAGGGTGTAGAATGAGAATGG - Intronic
1008352582 6:50510109-50510131 GAGTGCAGGTAGACTTAAAAGGG - Intergenic
1008663677 6:53695216-53695238 GGGCACAGGTAGAGTGAGGAGGG + Intergenic
1010219525 6:73436065-73436087 GGGAGGTGGGAGACTGAGACGGG + Intronic
1010359931 6:74981128-74981150 GGGGGCAGGTAGAAGGGGAAGGG + Intergenic
1010719616 6:79268035-79268057 GGGAAGAGGTAGACAGAGGAAGG + Intergenic
1013354131 6:109332446-109332468 GGAAGCAGGGAGAGGGAGAAGGG - Intergenic
1014386011 6:120803484-120803506 GGGAGCAGGCACAGTAAGAAAGG - Intergenic
1014888615 6:126814076-126814098 GAGAGCAGGGAGATAGAGAAAGG - Intergenic
1015103851 6:129513081-129513103 GGCAGCAGGTAAACAGAGAAGGG + Intronic
1015149468 6:130020688-130020710 GGCAGCAGGGGGACTCAGAAGGG - Intronic
1016281069 6:142419480-142419502 GGGTGCCTGTACACTGAGAATGG - Intronic
1016526910 6:145011663-145011685 GGGAAGAGGAAGACTGAAAAGGG + Intergenic
1016601528 6:145866900-145866922 GGGGGAAGGTAGACAGAGAGGGG + Intronic
1017505613 6:155066145-155066167 GGGAACAGGAAAATTGAGAAGGG - Intronic
1019472065 7:1226588-1226610 GGGAGCTGGAAGACTGCGAAGGG - Intergenic
1019488525 7:1300463-1300485 GGGAGGAGGTAGACAGAGCTTGG + Intergenic
1019675882 7:2312389-2312411 GGGAACAGGTAGGCTGTGATTGG - Intronic
1019871582 7:3768799-3768821 TGGAGAGGGTAGAATGAGAAAGG - Intronic
1021790244 7:24197414-24197436 GGGAGAGGCTAGAATGAGAAGGG - Intergenic
1022479752 7:30734930-30734952 GGGAGCAGGGAGAGCGAGACAGG + Intronic
1022567230 7:31415777-31415799 GGCAGCAGGGAGACTCAGAGAGG - Intergenic
1023187720 7:37549119-37549141 GGGAGCAGGAAGGGTGATAAAGG - Intergenic
1023273642 7:38494373-38494395 GGGGACAGGTGGACTGAGCAAGG + Intronic
1023277308 7:38533792-38533814 GGAAGAAGGCAGGCTGAGAAGGG - Intronic
1024223804 7:47309505-47309527 GTGAGGTGGTAAACTGAGAAAGG - Intronic
1025202750 7:56972132-56972154 GGGAGCAGGAAGCCCCAGAAGGG - Intergenic
1025669194 7:63604794-63604816 GGGAGCAGGAAGCCCCAGAAGGG + Intergenic
1027221756 7:76218524-76218546 GAGAGCAGGAAGACTGAGTAAGG + Intronic
1027966119 7:85010873-85010895 GGGAGTCAGTAGACAGAGAATGG + Intronic
1028530905 7:91837620-91837642 GGGAGCAGGCAAGCTGAGGATGG + Intronic
1029545631 7:101209017-101209039 GGCAGCAGGCAGAATGGGAAGGG + Intronic
1031507624 7:122606263-122606285 GGGAGAAGGATGACTGTGAAAGG + Intronic
1031679320 7:124651794-124651816 GGCAGCAGGGAGACTGAGGAAGG - Intergenic
1032705820 7:134420546-134420568 GGCAGCGGGTAGCCTGGGAAAGG - Intergenic
1034556208 7:151851970-151851992 GGGAGGAGCAAGACTGAAAACGG + Intronic
1035413530 7:158665675-158665697 AGGAGCAGGTCGACTGACAAGGG - Intronic
1036126726 8:6069815-6069837 GGATGCAGGTACACAGAGAAAGG - Intergenic
1036648385 8:10626002-10626024 GGGAGGGGGTAGACGGAGCAAGG + Intronic
1036727357 8:11231707-11231729 GAGAGAAGGAAGAGTGAGAAGGG + Intergenic
1037243875 8:16808428-16808450 TGGATCAGGCAGTCTGAGAATGG + Intergenic
1037849819 8:22318136-22318158 GTGAGCAGAGAGACAGAGAAAGG - Intronic
1037857067 8:22379464-22379486 GGGAGCAGATGGTCTGAGGATGG - Intronic
1037937051 8:22921942-22921964 GGGAGGAGGTAAACTGAGGGTGG + Intronic
1039450896 8:37674371-37674393 TGGAGCAGGGAGACTGAGGACGG - Intergenic
1040491320 8:47924975-47924997 GGGTGCAGGCAGGGTGAGAAGGG - Intronic
1040877396 8:52167673-52167695 GGCAGCAGGAAGACTTGGAAGGG + Intronic
1042346862 8:67736383-67736405 TAGAGCAGGTAGGTTGAGAAGGG - Intronic
1043288115 8:78560615-78560637 GGAAGCAGATGGACTGTGAAGGG + Intronic
1046044249 8:108945285-108945307 GGAATCTGGTAGAGTGAGAATGG - Intergenic
1046435725 8:114186287-114186309 GGAAGAAGGAAGAGTGAGAAGGG + Intergenic
1047180380 8:122582173-122582195 GGGAGAAGCTAGTCTGGGAAGGG - Intergenic
1047766148 8:127991682-127991704 GGGAGCAGAAAGACAGAGCAGGG + Intergenic
1048297290 8:133223721-133223743 GGGAACAGGCAGACAGGGAAGGG - Intronic
1048570188 8:135646507-135646529 GGGAAGGGGCAGACTGAGAAAGG - Intronic
1049273076 8:141706454-141706476 GGAGGCAGGTAGAGTGAGGAGGG - Intergenic
1049385529 8:142341247-142341269 GGGTGCAGGGAGGCTGGGAAGGG - Intronic
1050598610 9:7228434-7228456 GGATGCAGAAAGACTGAGAATGG + Intergenic
1051854461 9:21547664-21547686 GGGAGCATGTCCACTGTGAATGG - Intergenic
1056240582 9:84642545-84642567 AGAAGCAGGTGGACTGGGAAAGG - Intergenic
1056306310 9:85294304-85294326 TGGAGCAGGTAGAATGAGAAGGG + Intergenic
1056607396 9:88097610-88097632 GGGGGCAGGTGCAGTGAGAATGG + Intergenic
1056781268 9:89553024-89553046 GGGGGCAGGTAGAGTGGGCAGGG + Intergenic
1057043011 9:91860782-91860804 GGGAGTTGGTGGACTGAGTAGGG - Intronic
1057151553 9:92800444-92800466 GAGAGCAGGGGGACTCAGAAGGG + Intergenic
1057570362 9:96199702-96199724 GGGAGCAGCTAGTCTGAGCCTGG - Intergenic
1058162683 9:101586750-101586772 GGGAGCAGGGAGTCTGTGATTGG - Intronic
1059141529 9:111857560-111857582 GGGAGAAGGTAGAATGAGACAGG - Intergenic
1060834768 9:126746943-126746965 GGGAGGAGGGTGATTGAGAAAGG - Intergenic
1061453413 9:130681202-130681224 GGGGGAAGGGAGACGGAGAAGGG - Intronic
1062396162 9:136353703-136353725 GGGCCCAGGTGGACTGAGCAAGG - Intronic
1185679108 X:1873716-1873738 GAGAGAAAGGAGACTGAGAAAGG - Intergenic
1185679112 X:1873752-1873774 GAGAGAAAGGAGACTGAGAAAGG - Intergenic
1185679116 X:1873788-1873810 GAGAGAAAGGAGACTGAGAAAGG - Intergenic
1186163930 X:6806665-6806687 GGGAGCAGTTAGAGAGAAAAGGG + Intergenic
1186391200 X:9161306-9161328 GGCAACAGGGAGACAGAGAATGG + Intronic
1189234721 X:39478169-39478191 GGGAGCTGGGAGCATGAGAAAGG - Intergenic
1189266855 X:39723684-39723706 GGAAGGAGGAAGACAGAGAAGGG + Intergenic
1190626038 X:52339737-52339759 GGGAGAGTGTAGAATGAGAAGGG + Intergenic
1190896712 X:54626170-54626192 GGGAGAAGGGAGACTGGGGAGGG - Intergenic
1191055211 X:56233400-56233422 GGGAGCAGGGGGACTGGGAGGGG - Intronic
1191927260 X:66326977-66326999 GGTAGAAGCTAGACTGAGCAGGG - Intergenic
1195322200 X:103729066-103729088 GGGGGCAGGTAGACAGATGAAGG - Intergenic
1196110531 X:111942065-111942087 TGGAGCAGGGAAACTCAGAATGG - Intronic
1197593458 X:128438428-128438450 GGGACCAGGAACACAGAGAATGG + Intergenic
1197718609 X:129728559-129728581 GGGAGGGGGTAGACAGAGATGGG - Intergenic
1199892346 X:152098742-152098764 GGAAGCAGGAAGATTGAGGAAGG + Intergenic
1199982836 X:152930209-152930231 GGGAGCAGGGGGACAGAGAGGGG + Intronic