ID: 1071433549

View in Genome Browser
Species Human (GRCh38)
Location 10:85625643-85625665
Sequence AGGGAGCAGGTAGACTGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 419}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071433549_1071433557 14 Left 1071433549 10:85625643-85625665 CCTTCTCAGTCTACCTGCTCCCT 0: 1
1: 0
2: 1
3: 42
4: 419
Right 1071433557 10:85625680-85625702 GGAAAAAAATTGACATGGTGAGG No data
1071433549_1071433559 22 Left 1071433549 10:85625643-85625665 CCTTCTCAGTCTACCTGCTCCCT 0: 1
1: 0
2: 1
3: 42
4: 419
Right 1071433559 10:85625688-85625710 ATTGACATGGTGAGGGAGTCTGG No data
1071433549_1071433556 9 Left 1071433549 10:85625643-85625665 CCTTCTCAGTCTACCTGCTCCCT 0: 1
1: 0
2: 1
3: 42
4: 419
Right 1071433556 10:85625675-85625697 CAAAAGGAAAAAAATTGACATGG No data
1071433549_1071433558 15 Left 1071433549 10:85625643-85625665 CCTTCTCAGTCTACCTGCTCCCT 0: 1
1: 0
2: 1
3: 42
4: 419
Right 1071433558 10:85625681-85625703 GAAAAAAATTGACATGGTGAGGG No data
1071433549_1071433553 -7 Left 1071433549 10:85625643-85625665 CCTTCTCAGTCTACCTGCTCCCT 0: 1
1: 0
2: 1
3: 42
4: 419
Right 1071433553 10:85625659-85625681 GCTCCCTGGGTTGTTGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071433549 Original CRISPR AGGGAGCAGGTAGACTGAGA AGG (reversed) Intronic
900900741 1:5514042-5514064 AGGAGGCAGGGAGACTGGGAGGG - Intergenic
900939219 1:5787022-5787044 AGGGAGCAGGCAGGTAGAGAAGG + Intergenic
901316783 1:8315104-8315126 AGGGAGGAGGGAGAGTGAGGGGG - Intergenic
901434492 1:9238403-9238425 AGGGTCCAGGTAGACAGAGGAGG + Intronic
902134459 1:14292801-14292823 AGGAAACAGGTGCACTGAGAAGG - Intergenic
902216512 1:14937607-14937629 AGGGAGCAGGCACACTGGGGTGG - Intronic
902757051 1:18555877-18555899 AGGGAGCAGGTAGATTGCCCAGG - Intergenic
902921457 1:19668121-19668143 AGGGAGCAGGGATAGGGAGAAGG - Intronic
903925093 1:26826519-26826541 AGGGAAAAGGGAGACTGGGAGGG + Intergenic
905035246 1:34913983-34914005 AGGGAGAAGGGAGAATAAGAAGG + Intronic
905180108 1:36160301-36160323 AGGGAGCAGAGAGCCTGGGAGGG + Intronic
906322730 1:44827051-44827073 AGGAAGCTGGTGGACAGAGAGGG - Exonic
906657938 1:47562158-47562180 AAGGAGCAGGAGGACAGAGAGGG + Intergenic
907463514 1:54620225-54620247 AGGGGGCAGGTTCACAGAGAAGG + Intronic
914243279 1:145867078-145867100 AGTGAGCAGGTGGACTAAGGGGG - Intronic
914716756 1:150260269-150260291 AGGGAGGAGCTAGGGTGAGAAGG - Intronic
915598218 1:156907240-156907262 AGGGAGAAGGTAGACCTAGGTGG + Intronic
915644672 1:157260786-157260808 TGGGAGGAGGAAGAATGAGAGGG - Intergenic
915729301 1:158041846-158041868 AGGCAGCAGGTTGACTTGGATGG + Intronic
915900548 1:159843606-159843628 AGGGCCCAGGTTGGCTGAGAGGG - Intronic
916716008 1:167447289-167447311 TGGGATAAGGTAGATTGAGAAGG - Intronic
916889298 1:169101060-169101082 AGGCAGCAAGTATAATGAGAGGG + Intergenic
918039128 1:180901529-180901551 TGGGAGGAGGTGGATTGAGAAGG + Intergenic
920967474 1:210712993-210713015 ATGGAGAAGGTAGAGTGAGGAGG - Intronic
922240591 1:223753083-223753105 AGGGAGAAAGAAGACAGAGAGGG - Intronic
922857812 1:228790163-228790185 GGGGCGAAGGTAGACTGGGATGG + Intergenic
922879535 1:228970252-228970274 AGGGAGGAGGTAGAAAGTGAGGG - Intergenic
922973304 1:229761232-229761254 AGGAAGCAGGGACACAGAGAGGG - Intergenic
923100297 1:230809060-230809082 ATGTAGAAGGTAGACTGGGAAGG - Intergenic
924673532 1:246152471-246152493 AGTGAGCAGCTAGACTGAGGTGG - Intronic
1062970503 10:1644451-1644473 GGGGAGCAGGGAGAAGGAGAAGG + Intronic
1063100395 10:2945253-2945275 TGGCAGCAGGTAGAATGTGAAGG - Intergenic
1063402854 10:5764290-5764312 AGGTAGCATGGAAACTGAGATGG - Intergenic
1064053574 10:12079032-12079054 AGAGAGAAAGTAGACTGAGAAGG + Intronic
1064307251 10:14178550-14178572 AGGGGGCAGGAAGAGAGAGAGGG + Intronic
1067568053 10:47352181-47352203 AGGGAGCAGGGAGAGTGGGTTGG + Intronic
1068197749 10:53740236-53740258 ATGGGGCAGGAAGACTGAGAGGG + Intergenic
1068829906 10:61481794-61481816 AGGGAGAAGTTAAACTGTGATGG - Intergenic
1069885055 10:71618421-71618443 GGGGAGGAGGCAGGCTGAGAGGG - Intronic
1069917981 10:71798839-71798861 AGGGAGCAGGAAGGCCAAGAAGG + Intronic
1070793351 10:79202803-79202825 AAGGACCAGGTACAGTGAGAGGG + Intronic
1070935738 10:80293583-80293605 AGGCAACAGGAAGACAGAGAGGG + Intergenic
1071433549 10:85625643-85625665 AGGGAGCAGGTAGACTGAGAAGG - Intronic
1071953674 10:90733480-90733502 AGGAAGAAGGGAGATTGAGAAGG + Intergenic
1072174875 10:92910409-92910431 CGAAAGCAGGTAGACTAAGATGG + Intronic
1073365406 10:102936033-102936055 AGGGGGCTGGTAATCTGAGAGGG + Intronic
1073479445 10:103777327-103777349 AGGCGGCAGGGAGACTGAGAGGG + Intronic
1073632465 10:105162312-105162334 AGAGAGGAGGGAGAGTGAGATGG - Intronic
1073890080 10:108091084-108091106 AAGGAGAGGGTAGAGTGAGAAGG + Intergenic
1074193104 10:111155071-111155093 AGAGAGCAGGCAAGCTGAGATGG - Intergenic
1074394407 10:113085734-113085756 AGAGAGAAGGTAGACTGACAGGG - Intronic
1074518979 10:114199486-114199508 AGGAAGCAGGAAGAATGGGAAGG - Intronic
1076230131 10:128813415-128813437 AGGGAGCAGGGAGAGAGGGAGGG + Intergenic
1076978386 11:192494-192516 AGAGAGAAGGTGGCCTGAGAGGG - Intronic
1077066190 11:641975-641997 GGGAAGCAGGTAGTCGGAGAAGG - Intergenic
1077251134 11:1561214-1561236 AGGGAGCAGGGATACTGGGAAGG - Intronic
1077485859 11:2838165-2838187 AGGGACCAGGCAGACAGAGGTGG + Intronic
1078434652 11:11314498-11314520 GGGGAGCAGGCAGACAGGGAGGG - Intronic
1079034642 11:17011608-17011630 AGCCAGCAAGGAGACTGAGAAGG - Intronic
1079189389 11:18265153-18265175 AGGAAGGAGGAAGACAGAGAGGG + Intergenic
1079727601 11:23895367-23895389 CAGAAGCAGGGAGACTGAGAGGG + Intergenic
1081655560 11:44854778-44854800 AGGAAGCAGAGAGACAGAGAAGG - Intronic
1082730063 11:56785169-56785191 TGTGAGTAGGTAGACTGAGGTGG - Intergenic
1083364379 11:62132701-62132723 AGGGAAAGGGTAGACAGAGAGGG - Intronic
1083427121 11:62593919-62593941 AGGGTGCAGGTAGAGGGACAGGG + Exonic
1083683832 11:64364256-64364278 AGGGAGCAGGAGGAAGGAGAAGG + Intronic
1083777657 11:64902130-64902152 TGGGAATAGGTAGACGGAGATGG + Exonic
1084531346 11:69729650-69729672 GGGGCGCAGGTAGACTCCGATGG + Intergenic
1084668618 11:70592191-70592213 ACGGAGCAGGTAGAGTGAGGAGG - Intronic
1085537538 11:77232351-77232373 AGAGAGTAGGTTGACTGAGTGGG - Intronic
1085754213 11:79190814-79190836 AGGGAGAAGGGAGAGGGAGAGGG - Intronic
1086500070 11:87443761-87443783 AGGGAGAAGACAGACAGAGATGG + Intergenic
1086587087 11:88465013-88465035 TGGAAGCAGGTAGACTTAGATGG + Intergenic
1086607274 11:88710748-88710770 GGGGAGCAGTGAGATTGAGAAGG + Intronic
1087968883 11:104454529-104454551 AGGAAGCAGAGAGAGTGAGAGGG + Intergenic
1088406032 11:109480244-109480266 AGGGAGCAGGTAGGGGGTGAAGG - Intergenic
1089277881 11:117351642-117351664 AGGGAGAAGATGGAATGAGAGGG - Intronic
1089655601 11:119944583-119944605 AGGGAGCAGAGGGGCTGAGAGGG + Intergenic
1090406632 11:126479690-126479712 AGGGAGCAGGCAGCCTGTGAAGG - Intronic
1090900599 11:131027348-131027370 AGTGAGGAGGAAGAATGAGAGGG - Intergenic
1091972234 12:4797115-4797137 TGGGAGAAGGTGGACTGTGAAGG + Intronic
1092237709 12:6820441-6820463 AGGGGGTAGCTAGCCTGAGAGGG + Exonic
1092763911 12:11835548-11835570 TGGGAGCAAGTAGCCTGTGAAGG + Intronic
1092951211 12:13505251-13505273 AGGGAGAAGATAGACTAAGTTGG + Intergenic
1093262489 12:16956316-16956338 AGGGAAGAGGTAGATGGAGAAGG + Intergenic
1093774220 12:23053578-23053600 AGAGAGAAGGGAGACTGATATGG + Intergenic
1094057796 12:26284403-26284425 AGGGAGCAGGTGTGCCGAGAAGG + Intronic
1094548470 12:31427758-31427780 GGGCAGCATGGAGACTGAGACGG + Intronic
1095233115 12:39765657-39765679 TGAGAGGAGGTAGACTGAGCAGG - Intronic
1097364714 12:58699698-58699720 ATGGAGGTGGTAGAGTGAGAAGG + Intronic
1097608146 12:61781207-61781229 GGGGAGCAGGAAGCCTGAGAAGG + Intronic
1100817131 12:98397293-98397315 AGGCAGCAGGTAGGCAGGGAAGG + Intergenic
1101299979 12:103469157-103469179 AGGGAGCAGGGAGCTTGGGAAGG + Intronic
1101608905 12:106272363-106272385 AGGGAGCAGATTGAGAGAGATGG - Intronic
1101954267 12:109199528-109199550 TGGGAGCAGCTACGCTGAGATGG + Exonic
1102230359 12:111257601-111257623 AGGGAGGAGGAAGAGTGAGGAGG - Intronic
1102598738 12:114012868-114012890 AGGGAGGAGGGAGAGGGAGAGGG + Intergenic
1103120111 12:118372957-118372979 AGGGGGCGGGCGGACTGAGACGG - Intergenic
1103244143 12:119440719-119440741 AAGGAGAAGGTAAACTGTGATGG + Intronic
1103464084 12:121128177-121128199 AGGGAGAGGGTAGAGTGACATGG - Intergenic
1104585944 12:130048130-130048152 AAGGTGCTGGTGGACTGAGAAGG + Intergenic
1105425981 13:20295582-20295604 AGGGAGCAGGAGGACAGGGAGGG + Intergenic
1107562511 13:41571294-41571316 AGGGAGGAGGGAGAGGGAGACGG - Intronic
1108446456 13:50513545-50513567 AGGAAGCAGGTAGAATTAAATGG - Intronic
1108606803 13:52047476-52047498 AGGTAGTAGGAAGACTGAAAAGG + Intronic
1109771837 13:66984914-66984936 TGGGAACAGGGAGATTGAGATGG - Intronic
1110023398 13:70505573-70505595 AGGTAGCAGGTAGAAGGAGAGGG + Intergenic
1110179929 13:72604535-72604557 AGGCATCAAGTAGACTGAGAAGG + Intergenic
1112319356 13:98393074-98393096 GGGGAATAGGCAGACTGAGAGGG + Intronic
1114198323 14:20499015-20499037 AAGTAGCAGGCAGACTAAGAAGG + Intergenic
1115270750 14:31549698-31549720 AAGCAGGAGGAAGACTGAGATGG + Intronic
1115473738 14:33794751-33794773 AGGCAGAATGTAGACTGGGAAGG - Intronic
1115726126 14:36217832-36217854 TGGAAGCAGGTAGAGTGAGCTGG + Intergenic
1116639372 14:47441315-47441337 AGGGAGCAGGCAGACTGGTGAGG + Intronic
1117403993 14:55383917-55383939 AGGAAGCAGGCAGTCTGGGAAGG + Intronic
1117955696 14:61122005-61122027 AGGGGGCAGGCAGAGGGAGATGG + Intergenic
1118791444 14:69096939-69096961 GGGAAGGAGGGAGACTGAGATGG + Intronic
1120705217 14:87738890-87738912 TGTGAGCTGGTAGACTGAGTGGG + Intergenic
1120866890 14:89302784-89302806 AGGGTGGAGGTGGACAGAGAAGG - Intronic
1120870057 14:89328990-89329012 CAGGAGCAGGTAAGCTGAGATGG - Intronic
1121406625 14:93722967-93722989 AGGGATCAGGAAGGCTGGGAGGG + Intronic
1121469942 14:94144884-94144906 AGGAAGGAGGAACACTGAGAGGG - Intergenic
1122277383 14:100601311-100601333 AGGGAGCGGGGAGACAGAAATGG - Intergenic
1122613705 14:103002586-103002608 TGGGAGCAGGGACACTGAGCAGG + Intronic
1122825678 14:104369346-104369368 AGGGTGCAGGTCCACTGAAAGGG + Intergenic
1122885058 14:104707205-104707227 AGGGAGAAGGGAGCCGGAGAGGG - Intronic
1123106706 14:105845182-105845204 AGGGAGCGGAGGGACTGAGATGG + Intergenic
1124830225 15:33141607-33141629 AGGGAGCATGGAGACTGGGATGG + Intronic
1124956970 15:34366452-34366474 TGGGGGCAGGGAGGCTGAGAGGG - Intronic
1125164123 15:36682655-36682677 AGCTACCAGGGAGACTGAGATGG + Intronic
1125169454 15:36749837-36749859 AAGGAGCAGCAAGTCTGAGAAGG + Intronic
1125335579 15:38623103-38623125 AAGGGGCAGGGAGCCTGAGATGG - Intergenic
1125890077 15:43259066-43259088 GGGGAGAAGGTAGAAAGAGAGGG + Intronic
1126786497 15:52181120-52181142 AGGGAGCAGGTACAGAGAGGTGG - Intronic
1127332247 15:57950660-57950682 GGGAAGGAGGTAGAGTGAGATGG + Intergenic
1127660815 15:61098307-61098329 AGGAAGGAGGGAGACAGAGAGGG - Intronic
1128008235 15:64265969-64265991 AGCTAGTAGGTAGACTGAGATGG + Intronic
1128810987 15:70572516-70572538 GGGAAGAAGGTAGAGTGAGAGGG + Intergenic
1129252778 15:74318124-74318146 AGGGAGCAGAGAGACTAAGGGGG + Intronic
1129466509 15:75727228-75727250 AGGGAGCAGCTCGGCTGACAGGG - Exonic
1129961979 15:79695166-79695188 AGGGAGAAGGGAGAGAGAGAAGG - Intergenic
1130006450 15:80103715-80103737 AGGGAGAAAGCAGACTGAGAAGG - Intronic
1130221550 15:82023850-82023872 AGGCAGCAGGAAGAATGAAAGGG + Intergenic
1131258432 15:90876227-90876249 ATAGAGCAGGGAGACTGAGCTGG - Intronic
1131364311 15:91825251-91825273 GTGGAGCAGCTAGACTGACAGGG - Intergenic
1131626474 15:94125901-94125923 AGGTGGCAGGTAGACTCAGGTGG - Intergenic
1132026172 15:98406061-98406083 AAGGAGCAGGAAGATTGATAAGG + Intergenic
1132252515 15:100344667-100344689 AGGTAGCTGGTAGAGTAAGAGGG + Intergenic
1133340062 16:5030288-5030310 AGAAAGCAGGTAGAGTCAGAGGG + Intronic
1134089940 16:11386184-11386206 AGGGAACAGATGGCCTGAGAAGG + Intronic
1134890535 16:17837863-17837885 AGGTAGCTGATAGAATGAGATGG + Intergenic
1135657592 16:24264635-24264657 AGGGAGCAGGAAGAAAGAAAAGG - Intronic
1136034943 16:27532017-27532039 AGGAAGCAGGTGGACTGCGGGGG + Intronic
1136171996 16:28495268-28495290 AGGGGGCTGGAAGGCTGAGAGGG + Exonic
1136525344 16:30826019-30826041 GGGGAGAATGTGGACTGAGATGG - Intergenic
1137536091 16:49327371-49327393 AGGGAGAAGTTAGACAGGGAAGG - Intergenic
1137538797 16:49347850-49347872 TGGGAGCAGGGCCACTGAGAGGG - Intergenic
1137685606 16:50384845-50384867 AGGGGGCAGGAAGAATGAGGGGG - Intergenic
1137711816 16:50571953-50571975 AGGGAGCAGGGCGGCTGGGACGG - Intronic
1138332474 16:56226146-56226168 AGGGAGCAGGGAGACCAAGGAGG + Intronic
1138582297 16:57949484-57949506 AGGCAGGAGGTAGACTCAGCGGG - Intronic
1138916620 16:61472047-61472069 AGGTAGCAGGTAGACTTCTAAGG + Intergenic
1139476151 16:67203463-67203485 AGGGAGCGGGGACACTGAGCAGG - Intronic
1139927719 16:70500314-70500336 GGGGAACTGGGAGACTGAGAGGG + Intronic
1140929838 16:79617305-79617327 AGAGAGCAGGGACACTGAGATGG + Intergenic
1141519196 16:84566411-84566433 AGGGTCCAGGAAAACTGAGATGG + Exonic
1141527052 16:84618278-84618300 AGGGAGGAGGGAGAGTGAGAGGG - Intergenic
1141662100 16:85446920-85446942 AGGGAGCAGGCACACAGAGCAGG - Intergenic
1142135502 16:88450185-88450207 AGGGAGGAGGCACTCTGAGATGG - Intergenic
1142465814 17:136985-137007 AGAGAGAAGGTGGCCTGAGAGGG - Intergenic
1143296564 17:5875823-5875845 AGGTAGCAGGGAGACTGTGCTGG - Intronic
1143332674 17:6149122-6149144 AGGGAGGAGGTGGTTTGAGAGGG - Intergenic
1144058161 17:11559483-11559505 ACTGAGCAGGTAGACAGAGATGG - Exonic
1144838028 17:18167771-18167793 AGGGTGGAGGTGGGCTGAGAGGG - Intronic
1146938247 17:36825911-36825933 AGGCAGGAGGGAGGCTGAGAGGG - Intergenic
1146940052 17:36838155-36838177 AGGGAGGAGGAAAACTGTGATGG - Intergenic
1147133914 17:38424490-38424512 AGGAAGCAGGCAGCCAGAGAAGG - Intergenic
1147277722 17:39333134-39333156 AGGGAGGAGGGAGAGGGAGAGGG - Intronic
1147672690 17:42185650-42185672 AGGGAGCAGATAGACAGACAAGG - Intergenic
1147773907 17:42887013-42887035 AGGCAGCAGGAAGAGGGAGATGG + Intergenic
1147917369 17:43896773-43896795 ATGGAGCAGGAAGATTCAGAAGG - Intronic
1148211073 17:45809007-45809029 AGGGAGCAGGGAGGCTAAGCAGG + Intronic
1148272006 17:46268502-46268524 AGGCAGCAGGTATATTGTGATGG + Intergenic
1148478499 17:47944799-47944821 AGAGAGCAAGTAGACTGGGGGGG - Intronic
1148688399 17:49513269-49513291 AGGGGGCAGGTGGCCTGAGATGG - Exonic
1150554521 17:66242030-66242052 AGGGAGCAGGGAGCAAGAGAAGG - Intronic
1150764371 17:67992083-67992105 AGGCAGCAGGTATATTGTGATGG - Exonic
1151139223 17:71975721-71975743 AGGATGCAGGGAGACTGACAGGG + Intergenic
1151139501 17:71977942-71977964 AGGGAGATGGTAGCATGAGAAGG + Intergenic
1151178740 17:72310632-72310654 AGGAATCGGGTTGACTGAGAAGG + Intergenic
1153304475 18:3619491-3619513 AAGTAGCAGGGAGACTGAGTAGG + Intronic
1154095794 18:11413815-11413837 AGGAAGGAGGGAGGCTGAGAGGG - Intergenic
1155345049 18:24849497-24849519 TCAGAGAAGGTAGACTGAGATGG + Intergenic
1155600510 18:27540676-27540698 AGGGAGCTGGGAGATGGAGAAGG - Intergenic
1156180201 18:34594813-34594835 AGGGATAAGGAGGACTGAGAGGG - Intronic
1156352391 18:36312249-36312271 AGGGAGCAGAAGGATTGAGAAGG - Intronic
1157491983 18:48129924-48129946 AGGGAGCAGGGAGGCAGAGGAGG - Intronic
1157533510 18:48441769-48441791 AGGCAGCTGACAGACTGAGAAGG - Intergenic
1157565821 18:48678516-48678538 AGGTAGCAGGTCCACTGGGAAGG + Intronic
1158776945 18:60594147-60594169 AGGGAGTAGGGAAAATGAGATGG - Intergenic
1159266552 18:66087808-66087830 AGGGAGCAGGAAGAATGATTGGG - Intergenic
1159308077 18:66672016-66672038 AGCGGGCAGGTGGACTGAGTGGG + Intergenic
1161107449 19:2451694-2451716 AGGGCTCAGATAGCCTGAGATGG + Intronic
1161746748 19:6064794-6064816 AGGTAGGAGGTAGATTGAAAAGG - Intronic
1162765439 19:12916532-12916554 AAGGAGCAAGTAGAGTGACAGGG - Intronic
1163196279 19:15723344-15723366 CGGGAGCAGGAAGGCTGAGCCGG + Intergenic
1165322713 19:35096152-35096174 GGGGAGCAGGTAGACTGGAGAGG + Intergenic
1165890856 19:39111536-39111558 CTGGAGCAGGGAGAGTGAGAGGG + Intergenic
1166188871 19:41162022-41162044 CGGGAGCAGGGAGACAGAAATGG - Intergenic
1166417284 19:42605036-42605058 AGGCAGCGGGTAGACAGGGATGG + Intronic
1167338778 19:48902850-48902872 CTGGAGCAGGGAGAGTGAGAGGG + Intronic
1167612345 19:50513593-50513615 AGAGAGAAGGGAGACAGAGACGG + Intronic
1168063102 19:53905179-53905201 AGAGAGCAGCTAGACGCAGAAGG - Intronic
1168265873 19:55223753-55223775 AGGGAGCTGGTGGTCTGAGCCGG + Intergenic
925166525 2:1719180-1719202 GGGGAGCAGGTGGTGTGAGAAGG - Intronic
925422378 2:3723498-3723520 AGAGAGCAGGGAGGCTGGGAGGG + Intronic
926628146 2:15111423-15111445 AGGGAGCAGGTGGAATCAGTAGG + Intergenic
926803573 2:16684010-16684032 AGGGAGCAGATACAAAGAGAAGG - Intergenic
926885214 2:17591275-17591297 AGGGAGTAGGGAGACAGAGCAGG - Intronic
927289208 2:21388429-21388451 AGGGACCAGGTGGAGTGAGGAGG + Intergenic
928433970 2:31241808-31241830 AAGGAGAAGGTATTCTGAGAAGG + Intronic
928652811 2:33420361-33420383 AGGAAGCAGGTTGGCTGAGCTGG + Intergenic
929667125 2:43841732-43841754 AGGGAGCTGGCAGACAGAGGAGG - Intronic
930080515 2:47443451-47443473 AGGGAGCAGGTGAACTCATAAGG + Intronic
932839102 2:75064955-75064977 AGGCAGCAGGGAGACAGAAAGGG + Intronic
933294202 2:80471194-80471216 CGGAAGCAGGAAGACTGAGTAGG + Intronic
934558628 2:95300757-95300779 AGGGAGCAGCTGAGCTGAGACGG + Intronic
935863743 2:107362731-107362753 AGGGATCAGGTGGGATGAGAAGG + Intergenic
936466380 2:112755095-112755117 AGGGAGCATGTAAAATTAGATGG - Intronic
936937409 2:117851624-117851646 AGGGAGCAGGAAGGATGAGGTGG + Intergenic
937282188 2:120726174-120726196 GGGGAGCAGGGAGAGAGAGAGGG + Intergenic
938119758 2:128625229-128625251 AGGGAGCAGGTAGACAAAAGTGG + Intergenic
938314950 2:130318872-130318894 AGGGAGCAGGGAGAGGGAGCTGG - Intergenic
941774194 2:169374259-169374281 AAGGACCAGATAGAGTGAGATGG + Intergenic
941917301 2:170821273-170821295 AGGCAGCAGGTAGACCTTGAGGG + Intronic
942133695 2:172905065-172905087 AGGGAGCAGGTCGAGTGTTAAGG - Intronic
942659376 2:178247818-178247840 AAGGAGCAGGGAAACTGAAAGGG - Intronic
942816098 2:180056251-180056273 AGGGAGGAGAGAGACTGGGAGGG + Intergenic
944714014 2:202361095-202361117 AGGGAGAAGGGAGATGGAGATGG - Intergenic
946068608 2:217011623-217011645 ATGGTGTGGGTAGACTGAGATGG - Intergenic
946179780 2:217942419-217942441 AGGGAGGATGTGGATTGAGATGG - Intronic
946199666 2:218064462-218064484 AGGGAGGATGTGGATTGAGATGG - Intronic
948091888 2:235302053-235302075 AGGGAGGAGGAAGAGAGAGAAGG - Intergenic
1168918981 20:1515515-1515537 AGGGAGCACCTAGACTGGAAAGG - Intergenic
1169331470 20:4719910-4719932 AGAAAGCAGGAAGAATGAGATGG - Intergenic
1169887726 20:10419732-10419754 AACGAGCAGGTAGACAGACAAGG + Intronic
1170545671 20:17433937-17433959 AGAGAGAAGGTAGAGAGAGAGGG - Intronic
1170545683 20:17434002-17434024 AGAGAGAAGGTAGAGAGAGAGGG - Intronic
1170545693 20:17434071-17434093 AGAGAGAAGGTAGAGAGAGAAGG - Intronic
1170708475 20:18767324-18767346 AGGGAGCACGTAGAGGAAGAGGG + Intergenic
1170986678 20:21265632-21265654 AGGCAGCAGGTGGCCTCAGAGGG - Intergenic
1172392387 20:34574677-34574699 AGGGAGTAGATAGAGTGAGGGGG - Intronic
1172777906 20:37417845-37417867 GAGGAGCAGGAAGACAGAGAGGG - Intergenic
1173035960 20:39410641-39410663 ACGGAGCAGGTAGAGAGAGCGGG + Intergenic
1173294120 20:41740488-41740510 AGGGACCAGGGAGACTGTAAGGG - Intergenic
1173927772 20:46793464-46793486 ATGGAGCTGGAAGTCTGAGAAGG + Intergenic
1174993601 20:55541223-55541245 AAGGAGGAGGAAGAATGAGAGGG - Intergenic
1175008720 20:55712667-55712689 AGGGAACAGGAAGAGGGAGATGG + Intergenic
1175356470 20:58372952-58372974 AGGGAGCAGAGAGGCTGGGAAGG + Intergenic
1175661497 20:60816834-60816856 AGGGAGCAGGGAGCCGGAGGGGG + Intergenic
1178699068 21:34818372-34818394 AGGGAGGAGGGAGAAGGAGAGGG + Intronic
1179292397 21:40030191-40030213 GAGGAGCAGGGAGGCTGAGAGGG - Intronic
1179720887 21:43315517-43315539 GGGGAGGAGGGAGACTGGGAGGG + Intergenic
1180887538 22:19257744-19257766 AGGGGGCATCTAGAATGAGAAGG + Intronic
1181911196 22:26239641-26239663 AGGTAGCAGGTGGAGTTAGAAGG - Intronic
1183398279 22:37585739-37585761 AGGGGGCAGGTGGCGTGAGACGG - Intergenic
1184483508 22:44762188-44762210 AGTGAGCCGGAAGGCTGAGATGG + Intronic
1184491793 22:44814130-44814152 AGGAAGCATGGAGACTGGGAAGG + Intronic
950135909 3:10580638-10580660 TGGGAGCAGGGAGACAGGGAGGG - Intronic
951569433 3:24046636-24046658 AGGGAGAAGGTAGACAAAGGAGG - Intergenic
951602146 3:24388293-24388315 AGGGAGAAGTTGGACTGTGATGG - Intronic
953232500 3:41077304-41077326 AGGGAGCAGGAAGATTGAGCAGG - Intergenic
953620823 3:44531214-44531236 AGGAAGGAGGGAGACAGAGAAGG + Intergenic
953623835 3:44554613-44554635 AAGAAGCAGATAAACTGAGAAGG - Intergenic
953636956 3:44671977-44671999 AGGCAGCAGGTAGCCTTAGAGGG - Intergenic
955117331 3:56018544-56018566 AGGGAGCAGGCACACAGAGTGGG + Intronic
955239072 3:57164320-57164342 AGGGAGCAGGGAAGCTGAGAGGG + Intronic
955525643 3:59817022-59817044 AGGGAGCAGGTAGAAGCAGATGG + Intronic
956851011 3:73228155-73228177 AGGGAGAAGGGAGAGAGAGAGGG - Intergenic
958253734 3:91300450-91300472 AGGTAGGAGGAAGACTGAGAAGG - Intergenic
960436428 3:117632584-117632606 AGGGAGCAGGGAGATAGAGAAGG + Intergenic
961153594 3:124660360-124660382 TGGGAGAAGGAAGAGTGAGAGGG - Intronic
961802423 3:129462027-129462049 AGGGAACTGGAACACTGAGAGGG - Intronic
962016263 3:131443605-131443627 AGGGAGCAAGAAGAATGAGGCGG + Intergenic
962760553 3:138509254-138509276 AGGGAGCAGGAAGCATGGGAAGG + Intronic
963196492 3:142536681-142536703 AGGGGGCAGGTAGACTGGGCTGG - Intronic
965447360 3:168791661-168791683 AGGTAGAGGGTAGACTGGGAAGG + Intergenic
965603163 3:170474432-170474454 AGGGTGAAGGTAGAGTGTGAAGG - Intronic
965772243 3:172193257-172193279 AGGGGGAAGGTAGAGGGAGAGGG - Intronic
966682359 3:182656338-182656360 AGTAAGCTGGTAGACAGAGAAGG + Intergenic
967115749 3:186336178-186336200 AGGGAGAAGTTGGACTGAGATGG - Intronic
967230807 3:187335773-187335795 AGGGAGCAGGTATGCAGAGGTGG + Intergenic
967888061 3:194346434-194346456 AGGGAGCAGGGAGGCAGGGATGG + Intronic
968078933 3:195833559-195833581 AGGGAGCGGGATGACTGAGCTGG + Intergenic
968078957 3:195833657-195833679 AGGGAGCAGGATGAGTGAGGTGG + Intergenic
968122922 3:196138744-196138766 AGTGAGCATGTAAACTGATAAGG - Intergenic
968811156 4:2800235-2800257 AAGGAGGAGGGAGACTGAGCCGG - Intronic
969092890 4:4709154-4709176 AGGGAGCAGAGAGAGGGAGAAGG - Intergenic
969135782 4:5027677-5027699 AGGGAGGAAGTAGACCAAGATGG - Intergenic
969201225 4:5607997-5608019 AGGGAGCTGTTAGGATGAGAAGG - Intronic
969663827 4:8545562-8545584 AGGAAGCAGGTAGAGTGAGTAGG - Intergenic
970344333 4:15138577-15138599 AGGGAGCAGGTAGAGTATAATGG + Intergenic
970355910 4:15251827-15251849 AGAGAGCATGGAGACAGAGATGG + Intergenic
970934513 4:21553465-21553487 AAGAAGCATGGAGACTGAGATGG + Intronic
971394280 4:26214295-26214317 AGGAAGCAAGGAGACAGAGAAGG + Intronic
972371198 4:38424800-38424822 AGGGAACAGGAAGGCTGACAAGG - Intergenic
972639817 4:40915191-40915213 GGGAAGCAGGTAGATTGGGAGGG - Intronic
973068878 4:45832595-45832617 AGGGAACAGGGAGATTGAAATGG - Intergenic
975258668 4:72270443-72270465 AGGCAGGAGGTAGATTGAGGAGG + Intergenic
975871308 4:78781637-78781659 AGGGAGAGTGTAGAATGAGAAGG + Intronic
976171659 4:82310939-82310961 AGGGAGAGGGAAGAGTGAGAAGG - Intergenic
976990793 4:91362637-91362659 AGAGAGCATATAGATTGAGATGG + Intronic
977079201 4:92501551-92501573 AGGAAGAAGGCAGAATGAGATGG - Intronic
980334781 4:131457382-131457404 AGGGAGCAGTTTGAGAGAGAAGG - Intergenic
980787926 4:137578821-137578843 ATTGTGCAAGTAGACTGAGATGG - Intergenic
982753824 4:159194824-159194846 AGGGAACAGGTAGATAGGGAGGG - Intronic
982961301 4:161840885-161840907 AAGGAGGAGGGAGAGTGAGATGG + Intronic
984105590 4:175541416-175541438 AGAGAGCAGGCACACAGAGATGG + Intergenic
986221245 5:5770782-5770804 AGGGAACAGGAAGACTGGGTGGG + Intergenic
986406410 5:7429180-7429202 AAAGAGCAGGTACAGTGAGAAGG + Intronic
988514236 5:31891064-31891086 AGGAAGCAGCGAGAATGAGAAGG - Intronic
988832654 5:35002925-35002947 ATGGAGCAGGGAAACTGGGAAGG + Intronic
988870358 5:35383015-35383037 ATGGAGCACGTGGACTAAGATGG + Intergenic
990027074 5:51205783-51205805 AGGGAGCAGGGAGCCTGGGCTGG - Intergenic
990258556 5:53996869-53996891 AGGGAGCAGGAGCACTGGGATGG + Intronic
991674334 5:69076239-69076261 AGGAAGCAGGGAGTCTGAGATGG - Intergenic
994410142 5:99397135-99397157 AGGTACCTGGTAGACTGAGGTGG + Intergenic
995138182 5:108702803-108702825 TGTGAGGAGGTAGACAGAGAAGG - Intergenic
995697613 5:114898162-114898184 AAGGAGGAGGTAGAGAGAGATGG - Intergenic
996664009 5:126036588-126036610 AGGGGTCAGATAGACTGTGATGG - Intergenic
996791834 5:127301354-127301376 ATGGAGTTGGTAGACTGAAATGG + Intronic
998386518 5:141760234-141760256 AGGGGGCCGGTGGGCTGAGATGG + Intergenic
998965902 5:147539898-147539920 AGCCAGCTGGAAGACTGAGAAGG - Intergenic
999303461 5:150505239-150505261 CGGGAGCAGGTAGGCAGGGATGG - Intronic
999406757 5:151313327-151313349 AGGGAGGAGGTAGAGCAAGATGG - Intergenic
1001664630 5:173422107-173422129 AGGAAGCAGAGAGATTGAGAGGG - Intergenic
1001911093 5:175518476-175518498 AGGGAGCATGTAGCATGATATGG + Intronic
1002565124 5:180108499-180108521 AGGGAGAAAATAGACTGAAACGG - Intronic
1004272720 6:14210242-14210264 AGGGAGCAGATGGCCTCAGAAGG - Intergenic
1006236620 6:32638915-32638937 AAGGAGCAGGGAGTCAGAGATGG - Intronic
1006246587 6:32742490-32742512 AAGGAGCAGGGAGTCAGAGATGG - Intronic
1006402475 6:33825901-33825923 ATGGAGGAGGTAGGCAGAGAGGG - Intergenic
1006615153 6:35321211-35321233 AGGGGGCTGGAAGCCTGAGAAGG - Exonic
1007341760 6:41195081-41195103 AGGGAACAGGTGGCCTGACACGG - Intronic
1007459663 6:42008976-42008998 AGGGAACATGCAGACAGAGAGGG + Intronic
1008352583 6:50510110-50510132 AGAGTGCAGGTAGACTTAAAAGG - Intergenic
1008483821 6:52014143-52014165 AGGGTGGGAGTAGACTGAGAAGG - Intronic
1008663676 6:53695215-53695237 AGGGCACAGGTAGAGTGAGGAGG + Intergenic
1008734136 6:54521377-54521399 AGGCAACAGGAAGACAGAGATGG + Intergenic
1009190738 6:60626586-60626608 AGGTAGGAGGAAGACTGAGATGG + Intergenic
1010123283 6:72404892-72404914 AGAGAGCAGGGAGAGGGAGAGGG - Intergenic
1010219524 6:73436064-73436086 TGGGAGGTGGGAGACTGAGACGG + Intronic
1010345937 6:74811091-74811113 AGAGAGAAGGAAGACAGAGAAGG + Intergenic
1010359930 6:74981127-74981149 AGGGGGCAGGTAGAAGGGGAAGG + Intergenic
1010514236 6:76753596-76753618 AGGGAGAAGGAAGAGTGGGAAGG + Intergenic
1012290516 6:97450191-97450213 AGGGAGCATGAAGCCAGAGAGGG - Intergenic
1012758411 6:103263654-103263676 AGAGAGCAGGCACACAGAGATGG - Intergenic
1013608546 6:111773401-111773423 AGGGAGGGGGTAGAGTGAGCGGG + Intronic
1013747445 6:113362637-113362659 AGAAACCAGGAAGACTGAGAAGG - Intergenic
1013954609 6:115826499-115826521 ACTGAGCAGATAGACAGAGAAGG + Intergenic
1015103850 6:129513080-129513102 AGGCAGCAGGTAAACAGAGAAGG + Intronic
1015269326 6:131323656-131323678 TGGGTGCAGGTAGGCTGAGTCGG - Intergenic
1015326752 6:131932206-131932228 AGGGAGGAGGGAGACTGGGGAGG - Intergenic
1015443702 6:133278270-133278292 AGAAAGGAGGTAGTCTGAGAGGG - Intronic
1015972680 6:138758567-138758589 AGGGAGCAGGGAGAGAGGGAGGG - Intronic
1016526909 6:145011662-145011684 AGGGAAGAGGAAGACTGAAAAGG + Intergenic
1016601527 6:145866899-145866921 TGGGGGAAGGTAGACAGAGAGGG + Intronic
1017870412 6:158481976-158481998 AGGGAGGTGGCAGACTGAGCTGG - Intronic
1018238868 6:161753283-161753305 AGGGAGAAGGAACACAGAGAGGG + Intronic
1018329279 6:162710245-162710267 AGGGATCAGGTAGTATGAGAGGG - Intronic
1018471249 6:164100446-164100468 AGGGGGCACGTGGACTGAGCAGG - Intergenic
1018972612 6:168539123-168539145 AGTCAGCATGAAGACTGAGAGGG - Intronic
1019472066 7:1226589-1226611 GGGGAGCTGGAAGACTGCGAAGG - Intergenic
1019562042 7:1664235-1664257 AGGGAACAGGGAGACAGAGCGGG - Intergenic
1020108794 7:5436110-5436132 AGTGGCCAGGTAGACTGAGCAGG - Intronic
1020179426 7:5910163-5910185 AGAGGGCAGGTGGAGTGAGATGG + Intronic
1020303510 7:6814695-6814717 AGAGGGCAGGTGGAGTGAGATGG - Intronic
1020371692 7:7439114-7439136 AGGAAGCAGGATGACTGAAAAGG - Intronic
1023277309 7:38533793-38533815 AGGAAGAAGGCAGGCTGAGAAGG - Intronic
1023372056 7:39521573-39521595 ATGGAGCAGGAAAACTAAGAGGG + Intergenic
1023640775 7:42254729-42254751 AGTGGGCAGGTAGCATGAGATGG - Intergenic
1024488523 7:49948305-49948327 AGGGAGAAGGCAGAGTAAGATGG - Intronic
1024527696 7:50362816-50362838 AATGAGCAGGTTGATTGAGAGGG + Intronic
1026218422 7:68370066-68370088 AGGAAGCAGATGGACTGAGATGG + Intergenic
1026508545 7:71007678-71007700 ACTGAGGAGGGAGACTGAGAAGG - Intergenic
1026547220 7:71334005-71334027 AGGGAGCAGGTAGAAAGTGCTGG + Intronic
1029545630 7:101209016-101209038 AGGCAGCAGGCAGAATGGGAAGG + Intronic
1031353085 7:120759419-120759441 AGGGAGAAGGAAGACTGATTTGG + Intergenic
1031627843 7:124010557-124010579 AGGGAGCAGGGAGAGTTAAAAGG + Intergenic
1032436783 7:131907321-131907343 AGAAAGCAGGTAGAGTGAGAGGG + Intergenic
1032669382 7:134069348-134069370 AGGGAGGAGGAAGAAGGAGAAGG - Intergenic
1034101280 7:148452555-148452577 TGGGAGGAGGCAGGCTGAGATGG + Intergenic
1034102627 7:148463935-148463957 TGTCAGCAGGTAGACTGATAAGG - Intergenic
1035184100 7:157112290-157112312 AGGGTGCAGGTACAGGGAGAAGG + Intergenic
1035413531 7:158665676-158665698 TAGGAGCAGGTCGACTGACAAGG - Intronic
1036391043 8:8324554-8324576 AGGGAGTAGGGAGATGGAGATGG - Intronic
1036698932 8:10998442-10998464 ATGGAGAAGGGAGAGTGAGAAGG - Intronic
1036727356 8:11231706-11231728 AGAGAGAAGGAAGAGTGAGAAGG + Intergenic
1038323340 8:26549467-26549489 AGGGAGCAGAAAGACAGAAAGGG + Intronic
1039568158 8:38565569-38565591 AGGGAGGAGGGAGACAGGGAGGG - Intergenic
1039787671 8:40848071-40848093 AAGGAGCAGGTAGACAGAAGGGG - Intronic
1040877395 8:52167672-52167694 AGGCAGCAGGAAGACTTGGAAGG + Intronic
1041335657 8:56779626-56779648 AGGGAGTTCGTATACTGAGAGGG + Intergenic
1041830797 8:62150793-62150815 AGGCAGGAAGTAGGCTGAGAAGG - Intergenic
1042823565 8:72957579-72957601 AGTGAGCTGGTGGACTGAGTGGG - Intergenic
1042990931 8:74638888-74638910 GGGGAGTATGTAGAGTGAGAAGG + Intronic
1043402648 8:79899210-79899232 AGAGAGCAGGGAGAGTGAGATGG + Intergenic
1044374723 8:91456397-91456419 AGGGAGCAGACAGAGAGAGAGGG + Intergenic
1044726077 8:95195369-95195391 AGGGAGCAGCTGAAATGAGAGGG - Intergenic
1046435724 8:114186286-114186308 AGGAAGAAGGAAGAGTGAGAAGG + Intergenic
1046709870 8:117499031-117499053 AGAGAGCAGGCACACTGGGATGG - Intergenic
1046842041 8:118870019-118870041 AGGCAGCAGGTAGAAAGGGATGG + Intergenic
1048290588 8:133178428-133178450 AGGAAGCAGGGGGAGTGAGAGGG + Intergenic
1048297291 8:133223722-133223744 AGGGAACAGGCAGACAGGGAAGG - Intronic
1049273077 8:141706455-141706477 AGGAGGCAGGTAGAGTGAGGAGG - Intergenic
1050254183 9:3776931-3776953 AGGGATGAGGTAGAGTGTGATGG + Intergenic
1051365947 9:16321587-16321609 AGAGAGCAGGCAGAGTGAGTGGG + Intergenic
1051526565 9:18051367-18051389 AGGAAGCTGGTAGACTGTGTGGG + Intergenic
1053519559 9:38764092-38764114 AGGTAGGAGGTGTACTGAGATGG + Intergenic
1055169020 9:73232013-73232035 AGGCAGCAGGAAAAGTGAGAGGG - Intergenic
1056306309 9:85294303-85294325 ATGGAGCAGGTAGAATGAGAAGG + Intergenic
1056781267 9:89553023-89553045 AGGGGGCAGGTAGAGTGGGCAGG + Intergenic
1057018700 9:91678951-91678973 AAGAGGCAGGGAGACTGAGAAGG - Intronic
1057438336 9:95062953-95062975 AGGCAGGAGGTAGCCTGGGATGG - Intronic
1058606781 9:106731369-106731391 GGGAAGCAAGTAGACTGGGAAGG + Intergenic
1058781252 9:108337712-108337734 AAGGTGCAGGTAGCCTGGGAGGG - Intergenic
1059248398 9:112867162-112867184 AGGGAGGAGGAATCCTGAGAAGG - Intronic
1059248468 9:112867470-112867492 AGGGAGGAGGAATACTGAGGTGG - Intronic
1059391299 9:114001233-114001255 CAGGAGCAGGGAGACTGAAATGG - Intronic
1059509495 9:114830758-114830780 AGGGAGAAGGCAGACTGAGGAGG - Intergenic
1059793014 9:117661214-117661236 AGGGATCAGGAAGACAGAAATGG + Intergenic
1059936317 9:119314612-119314634 AGCGAGTAAGTAGACTGACAAGG - Intronic
1060579278 9:124729712-124729734 AGGAAGCATCAAGACTGAGATGG - Intronic
1061651638 9:132055014-132055036 AGGGAGCAGTGAGGCTGGGATGG - Intronic
1061859092 9:133459039-133459061 AGAGAGCAGCCAGGCTGAGATGG + Exonic
1061946804 9:133913115-133913137 AGGGAGCTGGCACTCTGAGAGGG + Intronic
1062315345 9:135964460-135964482 AGGAAACAGGGAGACTGGGAAGG - Intergenic
1062613700 9:137386810-137386832 AGGGAGCAGGTGTGCTGAGGGGG - Intronic
1185652822 X:1661236-1661258 AGGGGGCGGGAAGACAGAGAAGG - Intergenic
1186098980 X:6134828-6134850 AAAGAGCAGGCTGACTGAGAAGG + Intronic
1187575167 X:20546270-20546292 AGAGAGGAGGCAGAGTGAGATGG - Intergenic
1188678243 X:32969493-32969515 AGGAAGAAGGTAGACTTTGATGG - Intronic
1188986701 X:36774552-36774574 AGGGAGCAGCTAGCCTCAGGGGG - Intergenic
1189213902 X:39306982-39307004 AGGGAGGAGGCAGGTTGAGAAGG + Intergenic
1189262196 X:39687040-39687062 AGGAGGGAAGTAGACTGAGACGG + Intergenic
1190556215 X:51637997-51638019 AGGAAGAAGGTAGACTGGAAAGG - Intergenic
1190886935 X:54538684-54538706 AGGGAGCTGGCAGAATGAGAAGG - Intronic
1190896713 X:54626171-54626193 AGGGAGAAGGGAGACTGGGGAGG - Intergenic
1191055212 X:56233401-56233423 GGGGAGCAGGGGGACTGGGAGGG - Intronic
1191857914 X:65642546-65642568 GGGAAGCAAGTAGGCTGAGAGGG + Intronic
1192500317 X:71645874-71645896 AGGGAGGAGGGAGATGGAGAGGG + Intergenic
1193366871 X:80644628-80644650 AGGGAGGAGGTAGAGCGAGATGG - Intergenic
1193815686 X:86102263-86102285 AAGGAGAAGGAAGACTGGGAAGG + Intergenic
1196049997 X:111294677-111294699 TGGGAGCAGGGAGAGGGAGAGGG + Exonic
1196337294 X:114552266-114552288 AGGGAGGATGTAGTCTGAAATGG + Intergenic
1196900209 X:120375229-120375251 AGGTCACAGGTAGACTGAGTGGG + Intronic
1197718610 X:129728560-129728582 AGGGAGGGGGTAGACAGAGATGG - Intergenic
1198788241 X:140314154-140314176 AAGGAGAAGGTAGAGTGGGAAGG + Intergenic
1198891360 X:141400856-141400878 AGGGACCAGGAAGACTGTCAGGG - Intergenic
1199855614 X:151756575-151756597 AGGGAGGAGACAGACTGAGAAGG - Intergenic
1199982835 X:152930208-152930230 AGGGAGCAGGGGGACAGAGAGGG + Intronic
1200103562 X:153700340-153700362 GGGGAGCAGGAGGACAGAGAGGG + Intergenic
1200162094 X:154014893-154014915 AGGCAGGAAGTAGCCTGAGAGGG + Intronic