ID: 1071433553

View in Genome Browser
Species Human (GRCh38)
Location 10:85625659-85625681
Sequence GCTCCCTGGGTTGTTGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071433543_1071433553 23 Left 1071433543 10:85625613-85625635 CCCCCAGCAAACACCTTAGCAAG 0: 1
1: 0
2: 3
3: 57
4: 400
Right 1071433553 10:85625659-85625681 GCTCCCTGGGTTGTTGCAAAAGG No data
1071433545_1071433553 21 Left 1071433545 10:85625615-85625637 CCCAGCAAACACCTTAGCAAGCA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1071433553 10:85625659-85625681 GCTCCCTGGGTTGTTGCAAAAGG No data
1071433546_1071433553 20 Left 1071433546 10:85625616-85625638 CCAGCAAACACCTTAGCAAGCAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1071433553 10:85625659-85625681 GCTCCCTGGGTTGTTGCAAAAGG No data
1071433548_1071433553 -6 Left 1071433548 10:85625642-85625664 CCCTTCTCAGTCTACCTGCTCCC 0: 1
1: 0
2: 3
3: 39
4: 343
Right 1071433553 10:85625659-85625681 GCTCCCTGGGTTGTTGCAAAAGG No data
1071433549_1071433553 -7 Left 1071433549 10:85625643-85625665 CCTTCTCAGTCTACCTGCTCCCT 0: 1
1: 0
2: 1
3: 42
4: 419
Right 1071433553 10:85625659-85625681 GCTCCCTGGGTTGTTGCAAAAGG No data
1071433547_1071433553 10 Left 1071433547 10:85625626-85625648 CCTTAGCAAGCAGATTCCCTTCT 0: 1
1: 0
2: 3
3: 18
4: 180
Right 1071433553 10:85625659-85625681 GCTCCCTGGGTTGTTGCAAAAGG No data
1071433544_1071433553 22 Left 1071433544 10:85625614-85625636 CCCCAGCAAACACCTTAGCAAGC 0: 1
1: 0
2: 1
3: 9
4: 187
Right 1071433553 10:85625659-85625681 GCTCCCTGGGTTGTTGCAAAAGG No data
1071433542_1071433553 29 Left 1071433542 10:85625607-85625629 CCTTGTCCCCCAGCAAACACCTT 0: 1
1: 0
2: 0
3: 30
4: 314
Right 1071433553 10:85625659-85625681 GCTCCCTGGGTTGTTGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071433553 Original CRISPR GCTCCCTGGGTTGTTGCAAA AGG Intronic
No off target data available for this crispr