ID: 1071435091

View in Genome Browser
Species Human (GRCh38)
Location 10:85641533-85641555
Sequence CCACTCGTGCCTCTTCCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071435091_1071435095 -10 Left 1071435091 10:85641533-85641555 CCCATGGGAAGAGGCACGAGTGG 0: 1
1: 0
2: 0
3: 14
4: 120
Right 1071435095 10:85641546-85641568 GCACGAGTGGAATGAGGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071435091 Original CRISPR CCACTCGTGCCTCTTCCCAT GGG (reversed) Intronic
900270174 1:1782976-1782998 CCTCTGGTGCCCCTTCCCCTTGG - Intergenic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
900492468 1:2959144-2959166 CCATTTGTGCCTCTTCCCAGTGG - Intergenic
900532688 1:3162485-3162507 CCACTCCTGCCCCTTCCCCCCGG + Intronic
905005405 1:34705695-34705717 CCACTCGTGTCTCTTCCCTCAGG + Intergenic
905183554 1:36180512-36180534 CCTCTCTGGCCTCTTCCCTTGGG + Exonic
905479397 1:38250707-38250729 TCACTTCTGCCTCTTTCCATTGG + Intergenic
906762344 1:48387428-48387450 CCACTCGTACCTCAGCCCAGTGG - Intronic
909582046 1:77247539-77247561 CCACTTCTGCCCCATCCCATGGG + Intergenic
909583282 1:77262218-77262240 CCACTCCTTACTCTTGCCATTGG - Intergenic
915127953 1:153678993-153679015 CCGCTCCTGCTCCTTCCCATAGG + Exonic
918953712 1:191176136-191176158 TCACTAGTGGCACTTCCCATGGG + Intergenic
919972949 1:202592383-202592405 CCACCCCTGCCTCCTCCCATCGG - Exonic
921222586 1:212983775-212983797 CCACTCCTGCCTCTGCACCTTGG - Intronic
924284859 1:242475845-242475867 CTCCCCGTGCCTCTTCTCATGGG - Intronic
1063952543 10:11237398-11237420 ACACTCCTGCCTCACCCCATAGG - Intronic
1064929519 10:20608951-20608973 GCACTCCTGGCTCTTCCCAAAGG + Intergenic
1071435091 10:85641533-85641555 CCACTCGTGCCTCTTCCCATGGG - Intronic
1073025022 10:100481618-100481640 CCAACAGTGCCTCTTCGCATGGG - Intronic
1073185179 10:101611487-101611509 GCACACGTCCCTCTTCCCCTGGG - Intronic
1074765531 10:116697303-116697325 CCACTCGTGTCTCCTCCCACAGG - Intronic
1078195451 11:9133360-9133382 CCACTCTTGCTTCTGCCCCTAGG - Intronic
1080843501 11:36006090-36006112 CCAGTCGTTCCTCATCCCACAGG + Intronic
1083629417 11:64088061-64088083 CCTCCCCTGGCTCTTCCCATAGG + Intronic
1084192377 11:67504921-67504943 CCACTCCGTCCTCTTCCCAGGGG + Intronic
1084287328 11:68140733-68140755 CCACTGGGACCTCTTCCCAGTGG - Intergenic
1084750994 11:71204476-71204498 CCTGTGGTGCCTCTTCCCGTCGG - Intronic
1086224993 11:84497184-84497206 CCCTTCCTCCCTCTTCCCATAGG + Intronic
1091387614 12:104814-104836 CCTCTCCTGCCTCTTTCCATCGG + Intronic
1094426469 12:30321640-30321662 CCACACCATCCTCTTCCCATTGG + Intergenic
1097424061 12:59419804-59419826 CCCCTCTAGCCGCTTCCCATTGG - Intergenic
1101994955 12:109518627-109518649 CCACCCCAGACTCTTCCCATGGG - Intronic
1103750011 12:123151704-123151726 CCACCGGGGGCTCTTCCCATTGG - Intergenic
1106161289 13:27203396-27203418 CCACTCCTGCCTCCACCCCTCGG - Intergenic
1108027981 13:46198714-46198736 CCTCTTTTGCCTCTTCGCATTGG - Intronic
1110613690 13:77517668-77517690 AGACTCTTTCCTCTTCCCATTGG - Intergenic
1114071710 14:19115241-19115263 GCAATCGTGCATCTTCTCATCGG - Intergenic
1114090551 14:19284723-19284745 GCAATCGTGCATCTTCTCATCGG + Intergenic
1119380909 14:74227592-74227614 GCACTTCTGCCTCTTCCCACAGG - Intergenic
1119910489 14:78345513-78345535 CTACACCTGCCTCTTCCCAAGGG + Intronic
1121975792 14:98403096-98403118 CAACCCGGGCCTCTTCCCAAGGG - Intergenic
1122307257 14:100773715-100773737 CCTCTGGTGCCTCCTCGCATGGG + Intergenic
1126498796 15:49321732-49321754 CCACACGTGCCTCTCCCCTTGGG + Intronic
1126798918 15:52282666-52282688 CCACTCGTGCGCCCTCCCCTGGG + Intronic
1127143929 15:56005735-56005757 CCACTCCTGCCTCTTGTCAATGG - Intergenic
1127739822 15:61892102-61892124 CCACTCCTGGCTCAGCCCATGGG + Intronic
1129832178 15:78678112-78678134 CCAATCCTGCCTCTTCCCCTAGG + Intronic
1132870026 16:2111871-2111893 CCACTCGGGCCTGTCCCCACAGG - Exonic
1133118265 16:3590526-3590548 GCACCCGTGCCGCTTCCTATTGG - Exonic
1134240300 16:12501078-12501100 CCGCTTCTGCCTCTTCCTATGGG + Intronic
1135413353 16:22251129-22251151 CCCCTGTTGCCTCTTCCCACAGG + Exonic
1138194106 16:55040020-55040042 CCACGGGTAGCTCTTCCCATGGG + Intergenic
1141500930 16:84443560-84443582 CCACTCCTGCCTGTTCTCACTGG + Intronic
1141645156 16:85363514-85363536 CTCCTCCTGGCTCTTCCCATGGG + Intergenic
1141889683 16:86918267-86918289 CCCCTGGTGGCTCTCCCCATGGG + Intergenic
1144020256 17:11234670-11234692 CCATTCTTGCCTCTTCCCAGGGG + Intergenic
1144584895 17:16482109-16482131 CCACTCCTGCCCCTTTCTATTGG + Intronic
1144830843 17:18130475-18130497 CCACTCCTGCCTCTGACCATTGG - Intronic
1147324101 17:39662229-39662251 CCAATGATGCCTCTTTCCATAGG + Exonic
1148107827 17:45128624-45128646 CCACTCAGGCCTCTGCCCATGGG + Intronic
1148628667 17:49089913-49089935 ACACTAATGCCTTTTCCCATGGG - Intergenic
1149459364 17:56814524-56814546 CATCTCCTGCCTCTTCCCTTGGG - Intronic
1151182752 17:72341885-72341907 CCACTCTTGTCTCTTTCCAGAGG - Intergenic
1151428745 17:74048520-74048542 CCACTGCTGCCTCTTCCCCCTGG - Intergenic
1152622156 17:81370404-81370426 CCTCTCCTTCCTCTTCCCCTAGG - Intergenic
1157762103 18:50272838-50272860 CCCCTCCTGCCTCTTCCTCTGGG + Exonic
1167252092 19:48404840-48404862 CCACTCGTGCCCCTGGCCACCGG + Exonic
926239975 2:11077943-11077965 CCATCTGTGCCTCTTGCCATGGG - Intergenic
927155484 2:20218997-20219019 CCACTGGTTCCTCTCCCCACTGG - Intronic
929908298 2:46065899-46065921 CCACTCTTGCCTCTTGCCCATGG + Intronic
938092297 2:128441648-128441670 CCACCTGCGCCTCTCCCCATAGG + Intergenic
938485965 2:131708824-131708846 GCAATCGTGCATCTTCTCATCGG - Intergenic
942185485 2:173421122-173421144 CAACTAATGCCTCTTCCCCTTGG + Intergenic
946700883 2:222411916-222411938 CCATTCCTTCCTCCTCCCATGGG + Intergenic
947404504 2:229760809-229760831 CCACTCCTGCCCACTCCCATGGG + Intergenic
948363679 2:237440425-237440447 CCTCTCATGCATCTTTCCATGGG - Intergenic
1168912414 20:1459801-1459823 CCACTCATTCATCTTCCCAAAGG + Intronic
1170011497 20:11728507-11728529 CCACAGCTGCCTCTTCCCACAGG - Intergenic
1170695246 20:18651984-18652006 CCACTGGTTCCTGTCCCCATTGG + Intronic
1172922955 20:38502359-38502381 CCACTGGTGGCACTTCCTATGGG - Intronic
1176075014 20:63244453-63244475 CCCCTCGGGCCTCTTGCCTTTGG + Intronic
1178003523 21:28191865-28191887 GCACTCCAGCTTCTTCCCATGGG - Intergenic
1179950223 21:44704974-44704996 CCACTGGTGACTCTTCCCTGGGG + Intronic
1180718675 22:17890373-17890395 CCACTTCTGCCTGTTCCCTTTGG + Intronic
1181271510 22:21661363-21661385 CCACTCCTGCCTCTCCCTGTGGG + Intronic
1183381022 22:37490612-37490634 CCCCTCGTGTCTCCTCACATGGG - Exonic
950757011 3:15182606-15182628 CCACTAGTGCCTCCTCCCGGAGG + Intergenic
954042008 3:47895497-47895519 CCAGTCATGCCTCTGCCAATAGG - Intronic
954870871 3:53766645-53766667 TCCCTCGAGCCTCTTCCCACAGG - Intronic
956355768 3:68390399-68390421 CCACAGCTGCCCCTTCCCATAGG - Intronic
961131543 3:124472076-124472098 CAAATTGTGCATCTTCCCATAGG + Intronic
961323967 3:126098841-126098863 CCACTGGGGCCTGTTCCCAGAGG - Intronic
965728226 3:171743128-171743150 CCACTCATGCTTCCTCCCTTGGG + Intronic
966082752 3:176025088-176025110 ACACTCTTGCATCTTTCCATAGG - Intergenic
966086063 3:176068164-176068186 CCAGTTGTGCCTCTTCTCCTCGG - Intergenic
967815574 3:193795682-193795704 CCACTCCTGCCTCTTCCACATGG + Intergenic
969185787 4:5473359-5473381 CCACGCCTGCCACTGCCCATTGG - Intronic
969244298 4:5922534-5922556 CCACGCCTGCCCCTTCCCGTGGG - Intronic
969436226 4:7191243-7191265 CCTCCCTTCCCTCTTCCCATTGG + Intergenic
975770809 4:77720456-77720478 CCACTCCTGCCTCTTGTCAATGG - Exonic
980997072 4:139789524-139789546 CCACCCGTGCCTAGTCACATTGG - Intronic
981069914 4:140524097-140524119 CCCCTCCGGCCTCTTCCGATTGG - Intergenic
983928423 4:173427567-173427589 CAAAAGGTGCCTCTTCCCATAGG - Intergenic
992738622 5:79750070-79750092 TCACTAGTGCCACTTCCTATGGG - Intronic
993453581 5:88101542-88101564 CCACTCTTCCCTGTTACCATTGG + Intergenic
998191817 5:140031767-140031789 CCACTGGTGCCTTTGGCCATAGG - Intronic
998958870 5:147464275-147464297 TCACTCCTGCTTCTTCCCCTTGG - Intronic
1000721943 5:164719040-164719062 CTGCTTGTGCCTCCTCCCATTGG + Intergenic
1003302824 6:4899825-4899847 TCACACGTGACTCTTCCCCTCGG - Intronic
1003383368 6:5645428-5645450 GCACTCGTCCCTCATCCCTTAGG - Intronic
1003562094 6:7189304-7189326 CCACCTGTGCATGTTCCCATTGG - Exonic
1007384897 6:41513876-41513898 CCACTCTTGCCCCTTCCTCTAGG + Intergenic
1012351969 6:98262973-98262995 CCACTCATGCTTTTGCCCATGGG - Intergenic
1014535677 6:122610573-122610595 CCACTCCTCCCTCCTCGCATAGG - Intronic
1017473880 6:154768288-154768310 TCACTAGTGCCACTTCCCATGGG + Intronic
1019310455 7:357884-357906 CCACTCCTGCCCCTTCCAAGAGG + Intergenic
1019959541 7:4447622-4447644 CCACTTGTGCCTTTTTCCACTGG - Intergenic
1027737019 7:81945378-81945400 CCACTCCTGCCTCTTCTCTTGGG - Intergenic
1033810522 7:145006000-145006022 CCAGTTGTGCCTCTTGCCCTTGG + Intergenic
1034994236 7:155568116-155568138 CCACGTTAGCCTCTTCCCATAGG + Intergenic
1036410344 8:8494108-8494130 CCACTGCTGCCTCTTGCCATAGG + Intergenic
1038124361 8:24655052-24655074 CCACTCTTTTCTCTTCCCTTTGG + Intergenic
1041363489 8:57076061-57076083 TCACTCCTGCCACATCCCATGGG + Intergenic
1048124857 8:131623105-131623127 CCACTTATGCCTCATCTCATAGG - Intergenic
1049680012 8:143913913-143913935 CCACTCCTGCCTCTACCCCTTGG - Intergenic
1050044364 9:1527723-1527745 CCACTACTGCCTCTTCCGTTTGG + Intergenic
1058701044 9:107600500-107600522 CCTGTCCTGCCTCTTCCCAGGGG + Intergenic
1061764879 9:132875357-132875379 CCCCTCATGCCTCTGCTCATGGG - Intronic
1062628120 9:137452141-137452163 CCACCCCAGCCTCTTCCCCTTGG + Intronic
1188053888 X:25519325-25519347 CCACTGGTGACTCTCTCCATGGG + Intergenic
1190498859 X:51055521-51055543 CCACTCTTGCCTCTACCACTAGG + Intergenic
1190507357 X:51139288-51139310 CCACTCTTGCCTCTACCACTAGG - Intergenic
1193616657 X:83696503-83696525 CTACTTTTGCCTCATCCCATAGG + Intergenic
1198742227 X:139853203-139853225 CCTCTCCTTCCTCTTCCCCTAGG - Intronic
1198777485 X:140195805-140195827 CCACTCCTTCCTCTTCCTCTCGG + Intergenic