ID: 1071451071

View in Genome Browser
Species Human (GRCh38)
Location 10:85791873-85791895
Sequence CACAAAAGCCCAGGGTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071451071_1071451087 18 Left 1071451071 10:85791873-85791895 CCAGGGGACCCTGGGCTTTTGTG No data
Right 1071451087 10:85791914-85791936 GGCTGGGCTGTGGTCCAATGGGG No data
1071451071_1071451079 -9 Left 1071451071 10:85791873-85791895 CCAGGGGACCCTGGGCTTTTGTG No data
Right 1071451079 10:85791887-85791909 GCTTTTGTGCAGGGGGCATAGGG No data
1071451071_1071451085 16 Left 1071451071 10:85791873-85791895 CCAGGGGACCCTGGGCTTTTGTG No data
Right 1071451085 10:85791912-85791934 AGGGCTGGGCTGTGGTCCAATGG No data
1071451071_1071451084 8 Left 1071451071 10:85791873-85791895 CCAGGGGACCCTGGGCTTTTGTG No data
Right 1071451084 10:85791904-85791926 ATAGGGAGAGGGCTGGGCTGTGG No data
1071451071_1071451086 17 Left 1071451071 10:85791873-85791895 CCAGGGGACCCTGGGCTTTTGTG No data
Right 1071451086 10:85791913-85791935 GGGCTGGGCTGTGGTCCAATGGG No data
1071451071_1071451083 2 Left 1071451071 10:85791873-85791895 CCAGGGGACCCTGGGCTTTTGTG No data
Right 1071451083 10:85791898-85791920 GGGGGCATAGGGAGAGGGCTGGG No data
1071451071_1071451080 -4 Left 1071451071 10:85791873-85791895 CCAGGGGACCCTGGGCTTTTGTG No data
Right 1071451080 10:85791892-85791914 TGTGCAGGGGGCATAGGGAGAGG No data
1071451071_1071451081 -3 Left 1071451071 10:85791873-85791895 CCAGGGGACCCTGGGCTTTTGTG No data
Right 1071451081 10:85791893-85791915 GTGCAGGGGGCATAGGGAGAGGG No data
1071451071_1071451082 1 Left 1071451071 10:85791873-85791895 CCAGGGGACCCTGGGCTTTTGTG No data
Right 1071451082 10:85791897-85791919 AGGGGGCATAGGGAGAGGGCTGG No data
1071451071_1071451078 -10 Left 1071451071 10:85791873-85791895 CCAGGGGACCCTGGGCTTTTGTG No data
Right 1071451078 10:85791886-85791908 GGCTTTTGTGCAGGGGGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071451071 Original CRISPR CACAAAAGCCCAGGGTCCCC TGG (reversed) Intronic