ID: 1071451076

View in Genome Browser
Species Human (GRCh38)
Location 10:85791881-85791903
Sequence GCCCCCTGCACAAAAGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 170}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071451076_1071451086 9 Left 1071451076 10:85791881-85791903 CCCTGGGCTTTTGTGCAGGGGGC 0: 1
1: 0
2: 2
3: 15
4: 170
Right 1071451086 10:85791913-85791935 GGGCTGGGCTGTGGTCCAATGGG No data
1071451076_1071451084 0 Left 1071451076 10:85791881-85791903 CCCTGGGCTTTTGTGCAGGGGGC 0: 1
1: 0
2: 2
3: 15
4: 170
Right 1071451084 10:85791904-85791926 ATAGGGAGAGGGCTGGGCTGTGG No data
1071451076_1071451082 -7 Left 1071451076 10:85791881-85791903 CCCTGGGCTTTTGTGCAGGGGGC 0: 1
1: 0
2: 2
3: 15
4: 170
Right 1071451082 10:85791897-85791919 AGGGGGCATAGGGAGAGGGCTGG No data
1071451076_1071451083 -6 Left 1071451076 10:85791881-85791903 CCCTGGGCTTTTGTGCAGGGGGC 0: 1
1: 0
2: 2
3: 15
4: 170
Right 1071451083 10:85791898-85791920 GGGGGCATAGGGAGAGGGCTGGG No data
1071451076_1071451087 10 Left 1071451076 10:85791881-85791903 CCCTGGGCTTTTGTGCAGGGGGC 0: 1
1: 0
2: 2
3: 15
4: 170
Right 1071451087 10:85791914-85791936 GGCTGGGCTGTGGTCCAATGGGG No data
1071451076_1071451085 8 Left 1071451076 10:85791881-85791903 CCCTGGGCTTTTGTGCAGGGGGC 0: 1
1: 0
2: 2
3: 15
4: 170
Right 1071451085 10:85791912-85791934 AGGGCTGGGCTGTGGTCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071451076 Original CRISPR GCCCCCTGCACAAAAGCCCA GGG (reversed) Intronic
900621894 1:3591330-3591352 GACCCCTGCTCACAAGCCCTTGG + Intronic
900704246 1:4069149-4069171 TGCCTCTGCACAAAAGCTCAAGG - Intergenic
900890231 1:5444277-5444299 CCCCCCTGCACACAACCCTATGG - Intergenic
901186213 1:7375102-7375124 GCACCCTGCAGACAACCCCAGGG - Intronic
902992204 1:20196255-20196277 GCCACCTGCACACAAACCCTGGG + Intergenic
903832207 1:26182223-26182245 GCCCCCTGCCCAGAACCACAGGG - Intronic
904377970 1:30093749-30093771 TCCCTCTGCAGAAATGCCCATGG - Intergenic
905297348 1:36962549-36962571 CCCCACTGCACACAAACCCAGGG - Intronic
905515683 1:38560206-38560228 GCCCCCAGCACAAAAAGCTAAGG - Intergenic
909515241 1:76499576-76499598 CTCCCCTCCACTAAAGCCCAAGG - Intronic
910371738 1:86523844-86523866 GCCCCCTGCTCCACAGCCCCCGG - Intergenic
910770068 1:90822301-90822323 GCCTCCTGCCCCAAAGCCCCTGG + Intergenic
911650953 1:100387866-100387888 ACCCCCTCCAAAAAAACCCAAGG + Intronic
912518110 1:110228430-110228452 GGCCCCTCCACACCAGCCCAGGG + Intronic
919703593 1:200655606-200655628 GCCCCCTGCACACATGCACTTGG + Intronic
919930604 1:202218985-202219007 GCTCAGTGCACAGAAGCCCATGG + Intronic
919933314 1:202235712-202235734 GCCCCATGTACAACACCCCAGGG + Intronic
920068012 1:203282787-203282809 GCCCACTGCACATACTCCCAAGG - Intergenic
921941271 1:220842368-220842390 GACCCCTGCACAAAAGCAAATGG - Intergenic
923505891 1:234607192-234607214 TCCCCTTGCATAAAGGCCCAGGG + Exonic
924592438 1:245416510-245416532 CCCCACTACACAAAAGCCCCAGG - Intronic
1063582281 10:7318945-7318967 GCCGCCTGTACAAAGGCCCCGGG + Intronic
1065955157 10:30687386-30687408 ACCCCCTGCACAACAGCCTGGGG + Intergenic
1066658003 10:37712789-37712811 GCTCCATGTACAAAAGCACATGG + Intergenic
1067690196 10:48496962-48496984 GCCCCCTGCACAGAGCCCCAAGG - Intronic
1067774863 10:49155834-49155856 GCCCCGTGGAAAACAGCCCATGG - Exonic
1068022676 10:51604705-51604727 GCCCACTGCTCAAAACCCTAGGG + Intronic
1069216332 10:65825897-65825919 AGCCCCTGCAGAAAAGCCTAAGG - Intergenic
1069834994 10:71302638-71302660 GCTCCCTGCACCAAAGCTCCTGG - Exonic
1069960080 10:72074281-72074303 GCCTCCTGGACAAAGGCCGAAGG + Intronic
1071451076 10:85791881-85791903 GCCCCCTGCACAAAAGCCCAGGG - Intronic
1071491798 10:86141214-86141236 GCCCCCAACACACAAGCCCCAGG + Intronic
1073021393 10:100447681-100447703 ACCCCCTCCACAAAAACCCTAGG - Intergenic
1073637500 10:105214698-105214720 GACCCCTGCACCAAAGTCAATGG + Intronic
1074190023 10:111127608-111127630 GCCCCCTGCAGACATGGCCAGGG + Intergenic
1075729034 10:124625507-124625529 GACCCCTGCACAACAGCCCCAGG + Intronic
1077113069 11:870370-870392 CCTCCCTGCACACAAGGCCAAGG + Intronic
1077243746 11:1525702-1525724 GCCACCTCCAGAAAAGCCCCTGG + Intergenic
1083519527 11:63295636-63295658 ACCCCCTGCAGACAAGCCCTTGG - Intronic
1085405515 11:76259545-76259567 GCCCCTGGCAGAACAGCCCATGG + Intergenic
1085530946 11:77191696-77191718 GGCCCCCGCCCACAAGCCCAGGG + Intronic
1085759448 11:79229206-79229228 GGCCCCTGGCCAAAAGCTCAGGG + Intronic
1088761148 11:112930074-112930096 GCTCCCTGCACAGAAGCACGGGG + Intergenic
1090666475 11:128918158-128918180 GCCCACTGCTGAAAAGCCCCTGG + Exonic
1090908041 11:131094594-131094616 TCCCCCTGCTCTCAAGCCCAGGG + Intergenic
1091889908 12:4045135-4045157 GACCCCGGCAGAAAACCCCAAGG - Intergenic
1092943934 12:13435955-13435977 GCCTCTTACACACAAGCCCAAGG - Intergenic
1093212449 12:16324301-16324323 GCCCCATGCACCAAAGCTTATGG - Intergenic
1094269979 12:28602770-28602792 ACCCACTGCAAAAGAGCCCACGG + Intergenic
1095279362 12:40332228-40332250 TCCCCCTGAACTAAAGTCCAGGG + Intronic
1105605119 13:21920733-21920755 GCCCCCTGCTCCACAGCCCCCGG - Intergenic
1109700610 13:66020047-66020069 GCTCTCTGAACAAAAGCCCTAGG - Intergenic
1111602766 13:90495068-90495090 TCCGGCTGCACAGAAGCCCATGG - Intergenic
1120819889 14:88902245-88902267 GCCCCATGGACAGAACCCCAGGG - Intergenic
1121277297 14:92677112-92677134 GCCCCTTGCTCATAAGCCCTGGG + Intronic
1122121057 14:99553761-99553783 AAGCCCTGCACAGAAGCCCAGGG + Intronic
1122939002 14:104972910-104972932 GCCCCCTGAGCCAGAGCCCAGGG - Intronic
1124649972 15:31467391-31467413 GCCCCCTGGAGAAAAGTCCCTGG + Intergenic
1125515886 15:40320915-40320937 GCCTCCTCCACAAAATCCCTGGG - Intergenic
1126506276 15:49407254-49407276 TCCTCCTGCACTAAGGCCCATGG + Intronic
1128332355 15:66763838-66763860 GCCCCCTGGCCAAACGCCCTAGG + Intronic
1129269139 15:74410296-74410318 GCTCCCAGCCCAAGAGCCCATGG - Exonic
1129709272 15:77812228-77812250 GCCCTCTGCAGAGCAGCCCAGGG + Intronic
1132506496 16:312214-312236 GCCGCCAGCACAAAAGCTGAGGG + Intronic
1133283119 16:4678181-4678203 GCCCCTTGCACAGCAGCGCATGG - Intronic
1134843870 16:17423562-17423584 GACTCCTGCACAAAAGCCCAGGG - Intronic
1136147425 16:28323559-28323581 GCCCACTGAACAGAACCCCACGG + Exonic
1137400124 16:48146443-48146465 GTCCCCAGGCCAAAAGCCCAGGG - Exonic
1138073308 16:54015518-54015540 GCCCATGGCACAAATGCCCATGG + Intronic
1140876063 16:79153495-79153517 GACCCCTGGAGAACAGCCCACGG + Intronic
1142009208 16:87705211-87705233 GCGGCCGGCACGAAAGCCCAGGG - Intronic
1142471211 17:164311-164333 GCCCCTTTCACAGAAGCCCCCGG + Intronic
1143373251 17:6453526-6453548 GCATCCTGCACTCAAGCCCAGGG - Exonic
1150978629 17:70117877-70117899 ACACCCTGCTCTAAAGCCCAAGG - Intronic
1151342260 17:73479283-73479305 GCCTGCTGCCCAAAAGTCCATGG - Intronic
1152175269 17:78782652-78782674 GGCTACTGCACGAAAGCCCAAGG + Intergenic
1152739437 17:82012557-82012579 GGCCCCAGCACAGCAGCCCAGGG - Intronic
1152898566 17:82927390-82927412 TCTCCCTGCAGAAAAGCCCGGGG - Intronic
1153104374 18:1510609-1510631 GTCCACTGCACAAGAGCCCAAGG - Intergenic
1153814833 18:8783336-8783358 GCCCCCTCCACAAAGCCCCTGGG + Intronic
1156500140 18:37552330-37552352 GCCCCCTGCAGGAAAGCCCCAGG - Intronic
1157280598 18:46344410-46344432 ACCCCCTCCTCAAAAGCTCAGGG + Intronic
1157684153 18:49629376-49629398 GCCCCCTGCAGGAGAGGCCAGGG + Intergenic
1160178144 18:76612651-76612673 GAGCCCTGCCCAAAAGCTCATGG + Intergenic
1161124063 19:2546220-2546242 GCCCGCTCCACAGAACCCCAGGG + Intronic
1161134658 19:2612531-2612553 TCCCACGGCACAAAAGCCCCAGG + Intronic
1161537767 19:4830882-4830904 GCCACCTGCCCAAAGGCCCTGGG + Intronic
1163557228 19:17999660-17999682 GCTCCCAGCACCCAAGCCCATGG - Exonic
1163701171 19:18787352-18787374 GCGCCCTGGACCAAAGACCATGG - Intronic
1165068915 19:33244012-33244034 GCCACCAGCACAAAAGCCCTGGG - Intergenic
1166300941 19:41911945-41911967 GCCCCCAACACAGAGGCCCAGGG + Intronic
1167713388 19:51125674-51125696 GTCCCCTGCTCACAGGCCCAGGG - Exonic
1167716263 19:51144483-51144505 GTCCCCTGCTCACAGGCCCAGGG - Exonic
925056381 2:860616-860638 GCCCCCTCCACACCAGCCCCCGG + Intergenic
926147051 2:10402869-10402891 GCAGCCTGCGCAAAACCCCAGGG + Intronic
932559509 2:72855014-72855036 GAGCCCTGCAGGAAAGCCCAGGG + Intergenic
933384700 2:81595401-81595423 GCCTCATGCACAAAAGACAATGG + Intergenic
934052053 2:88219411-88219433 GCCTCCTCCACACAAGCCCAGGG + Intergenic
934296713 2:91748481-91748503 GCCCCCCGAAAAAAAGCTCAAGG - Intergenic
938106513 2:128534786-128534808 AACCCCTGCACCCAAGCCCAAGG + Intergenic
938780887 2:134583783-134583805 GCCCCCTGCTCTCAGGCCCATGG + Intronic
939830722 2:147067343-147067365 GGCCCCTTCACAAAAGCTCATGG - Intergenic
941847078 2:170143759-170143781 ACCTCCTGCCCACAAGCCCAAGG - Intergenic
942170209 2:173282621-173282643 GCCCCCTGCTCCACAGCCCCTGG - Intergenic
946400332 2:219465172-219465194 GGCCCCTGCACATATGCCCCAGG - Intronic
948362020 2:237428665-237428687 GAGCCCTGCACAAACTCCCAAGG + Intergenic
1168732967 20:103440-103462 GCCCCATGCACAAAAGCTCCTGG - Intergenic
1168849711 20:968134-968156 GCCCACTGCCCACAAGACCAGGG + Exonic
1170940383 20:20843765-20843787 CACCCCTGCACACAGGCCCAGGG + Intergenic
1177983908 21:27949066-27949088 GACCCCCGCACAGAAGCTCATGG - Intergenic
1179560528 21:42213337-42213359 TGGCCCTGCACAGAAGCCCAAGG - Intronic
1180086477 21:45510001-45510023 GCCCCCTGCACCCAGGCCCCGGG - Intronic
1180127963 21:45804950-45804972 GCCCATTTCACAAAAGCACAGGG - Intronic
1180140087 21:45888011-45888033 GCCCCCTCCGGAAATGCCCATGG - Intronic
1181106489 22:20578870-20578892 GCCCTCTGGAGAAGAGCCCATGG - Intronic
1184186719 22:42869644-42869666 GACCCCTGCCCAAAAGGCCACGG - Intronic
1184546308 22:45171123-45171145 GCCCACTGTACGAAAGGCCACGG - Intronic
949954094 3:9253017-9253039 TCTCCCTGCACACAAGCACAGGG + Intronic
958617157 3:96510078-96510100 CCCCCCTGCAGAGAAACCCAGGG + Intergenic
961726361 3:128933478-128933500 GCCCACTGCACACCAGGCCATGG - Intronic
969326812 4:6448837-6448859 GCCACCTGCACGAAGGCTCACGG + Intronic
969433273 4:7168447-7168469 GCCCACAGCACAAAGGCTCAGGG - Intergenic
969680591 4:8641268-8641290 GCGCCCAGCACAACAGCACAGGG + Intergenic
972739191 4:41874498-41874520 GCCCCCTGGGCCAAAGGCCAGGG - Intergenic
976399179 4:84588211-84588233 GCCCCATGCACAAACACACAGGG - Intronic
978587737 4:110292010-110292032 GCCCCTTGCATATGAGCCCAAGG - Intergenic
986195455 5:5533509-5533531 AGCCCCTGCTCAACAGCCCAAGG - Intergenic
986498542 5:8372935-8372957 GCCTCCTGCACACAACCCCTGGG - Intergenic
986931324 5:12826292-12826314 GCACCCAGAACCAAAGCCCAAGG - Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
1001586716 5:172837883-172837905 GCCTTCTGCACACCAGCCCAGGG + Intronic
1001948241 5:175797542-175797564 GAGCCCTGCACAGAAGCCCGCGG + Intronic
1003578072 6:7315464-7315486 TCCGGCTGCACAGAAGCCCATGG - Intronic
1004002492 6:11607891-11607913 AGCCCCTGCCCACAAGCCCAAGG - Intergenic
1014852829 6:126362253-126362275 ACCCTATGCACAAAAGCTCATGG + Intergenic
1015576804 6:134680265-134680287 CACCCCTCCACAAAAGCTCAAGG - Intergenic
1016337137 6:143018955-143018977 GCCACCTGGAGAAAAACCCAAGG - Intergenic
1016395616 6:143620748-143620770 TCCCCCTGCATAAAAGCCAATGG - Intronic
1018081286 6:160261392-160261414 GCCCCCTGCACAAAAAGACACGG + Intronic
1018941360 6:168310477-168310499 CCCCCATCCAGAAAAGCCCAGGG + Intronic
1019176572 6:170162293-170162315 GGGCCCTGCACTGAAGCCCACGG + Intergenic
1020463419 7:8449110-8449132 GCCCCCTGGCCAAAGGCCCCTGG - Intronic
1023997910 7:45173409-45173431 GCAGCCTGGACAATAGCCCAGGG - Intronic
1027050786 7:75019970-75019992 GCCCCATTCACACCAGCCCAGGG - Intronic
1027308618 7:76929274-76929296 ACTCCCTGCACAAATACCCATGG + Intergenic
1033424614 7:141232822-141232844 GCCCCCTGCTACAAAGCCCTTGG + Intronic
1034152571 7:148928530-148928552 TCCCCCTGCCCAAATTCCCAAGG + Intergenic
1034399081 7:150849556-150849578 GCCAACTGCACAACACCCCATGG + Intronic
1036503224 8:9332418-9332440 GCCTACAGCACAAAAGCCCTAGG - Intergenic
1036706291 8:11049442-11049464 GCCCCCTGCAGAGAGGCGCAGGG - Intronic
1039392866 8:37196033-37196055 GCCACCTTCATCAAAGCCCATGG + Intergenic
1039550013 8:38436563-38436585 GCAGCCTGCACAAATTCCCAAGG - Intronic
1040288151 8:46110880-46110902 GCACCCTGCTCCAAAGCCTATGG + Intergenic
1040300729 8:46186698-46186720 GCACCCTGCTCCAAAGCCTAAGG + Intergenic
1040304477 8:46204970-46204992 GCTCCCTGCTCCAAAGCCTAGGG - Intergenic
1040307323 8:46218910-46218932 GCACCCTGCTCCAAAGCCTATGG + Intergenic
1040325842 8:46341098-46341120 GCACCCTGCACTAAAGCCTGGGG - Intergenic
1040333366 8:46403666-46403688 GCACCTTGCTCAAAAGCCTAGGG - Intergenic
1040338227 8:46426937-46426959 GCACCCTGCTCAAAAGCCTGGGG - Intergenic
1041668942 8:60473593-60473615 TTCCCCTTCACAAAAGCCCTGGG - Intergenic
1042615256 8:70642011-70642033 GGCCCCTGCACAAAACCTGATGG + Intronic
1043819675 8:84847135-84847157 GCCCCCTACACAAAATCCCTTGG + Intronic
1049332584 8:142063142-142063164 GCCACCTGGACAAAAACCCCTGG - Intergenic
1050677401 9:8071505-8071527 GCCCTGTGCACAAAACCCCCTGG + Intergenic
1053493182 9:38526890-38526912 GCCCCTTGCAGAAGACCCCACGG - Intergenic
1054717230 9:68568317-68568339 CCCACCTCCACAAAACCCCAAGG + Intergenic
1055922779 9:81479127-81479149 GCCCCATCCACAATAGCCAAAGG + Intergenic
1056209696 9:84354274-84354296 GCCCCATGCAGGAGAGCCCATGG - Intergenic
1057780248 9:98044050-98044072 ACCCACTCCACAAAAGCCCTAGG - Intergenic
1058661893 9:107274164-107274186 GCCCTCTTCACCAAAGCCTAAGG - Intergenic
1060245375 9:121941667-121941689 GCCCTCTGAACAAAAGCACTGGG - Intronic
1061550860 9:131333986-131334008 GGCACATGCACAAAAGCCCGGGG - Intergenic
1062077770 9:134601163-134601185 GCCCCCTGCCCAGAAGCTGAGGG - Intergenic
1062099305 9:134719933-134719955 GCCCCTGGCACACAAGCGCAAGG - Intronic
1062396807 9:136355874-136355896 GGCCCCTGCAGACAAGCCCAAGG - Intronic
1186247627 X:7631446-7631468 GCCCCATACACAAAGGCCCCCGG - Intergenic
1186618294 X:11212981-11213003 GCCCCCTGCAGGCATGCCCATGG + Intronic
1187415217 X:19087323-19087345 GTGCCCTGCACAAAGGCTCACGG + Intronic
1187854723 X:23625839-23625861 GCCCCCATCCCAAAAGACCACGG + Intergenic
1192694318 X:73398662-73398684 GCCCTGTGCACAAAAGCCCATGG + Intergenic
1192803482 X:74490398-74490420 ACCCACTCCACAAAAGCCCCAGG - Intronic
1194205239 X:91003416-91003438 ACCCACTCCACAAAAGCCCTAGG + Intergenic
1196523063 X:116696141-116696163 TCTCGCTGCACAAAAGCCCTAGG - Intergenic
1198975176 X:142327941-142327963 GGCTCCTGCACCAAAGCCCCTGG + Intergenic
1199219727 X:145304209-145304231 GCCAGCTGCATAAAAGCACAAGG - Intergenic
1199369927 X:147035416-147035438 GCCTCAGGCACAAAAGCCCCTGG + Intergenic
1200551056 Y:4578553-4578575 ACCCACTGCACAAAAGCCCTAGG + Intergenic
1200930202 Y:8690089-8690111 GCCACCTGAACACAGGCCCATGG + Intergenic