ID: 1071451076

View in Genome Browser
Species Human (GRCh38)
Location 10:85791881-85791903
Sequence GCCCCCTGCACAAAAGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071451076_1071451087 10 Left 1071451076 10:85791881-85791903 CCCTGGGCTTTTGTGCAGGGGGC No data
Right 1071451087 10:85791914-85791936 GGCTGGGCTGTGGTCCAATGGGG No data
1071451076_1071451082 -7 Left 1071451076 10:85791881-85791903 CCCTGGGCTTTTGTGCAGGGGGC No data
Right 1071451082 10:85791897-85791919 AGGGGGCATAGGGAGAGGGCTGG No data
1071451076_1071451083 -6 Left 1071451076 10:85791881-85791903 CCCTGGGCTTTTGTGCAGGGGGC No data
Right 1071451083 10:85791898-85791920 GGGGGCATAGGGAGAGGGCTGGG No data
1071451076_1071451086 9 Left 1071451076 10:85791881-85791903 CCCTGGGCTTTTGTGCAGGGGGC No data
Right 1071451086 10:85791913-85791935 GGGCTGGGCTGTGGTCCAATGGG No data
1071451076_1071451084 0 Left 1071451076 10:85791881-85791903 CCCTGGGCTTTTGTGCAGGGGGC No data
Right 1071451084 10:85791904-85791926 ATAGGGAGAGGGCTGGGCTGTGG No data
1071451076_1071451085 8 Left 1071451076 10:85791881-85791903 CCCTGGGCTTTTGTGCAGGGGGC No data
Right 1071451085 10:85791912-85791934 AGGGCTGGGCTGTGGTCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071451076 Original CRISPR GCCCCCTGCACAAAAGCCCA GGG (reversed) Intronic