ID: 1071451085

View in Genome Browser
Species Human (GRCh38)
Location 10:85791912-85791934
Sequence AGGGCTGGGCTGTGGTCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071451071_1071451085 16 Left 1071451071 10:85791873-85791895 CCAGGGGACCCTGGGCTTTTGTG No data
Right 1071451085 10:85791912-85791934 AGGGCTGGGCTGTGGTCCAATGG No data
1071451077_1071451085 7 Left 1071451077 10:85791882-85791904 CCTGGGCTTTTGTGCAGGGGGCA No data
Right 1071451085 10:85791912-85791934 AGGGCTGGGCTGTGGTCCAATGG No data
1071451076_1071451085 8 Left 1071451076 10:85791881-85791903 CCCTGGGCTTTTGTGCAGGGGGC No data
Right 1071451085 10:85791912-85791934 AGGGCTGGGCTGTGGTCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071451085 Original CRISPR AGGGCTGGGCTGTGGTCCAA TGG Intronic